Saturday, November 30, 2019

Phenylalanine hydroxylase (PAH) Gene Essay Example

Phenylalanine hydroxylase (PAH) Gene Paper Phenylalanine hydroxylase (PAH) Gene Background: We will write a custom essay sample on Phenylalanine hydroxylase (PAH) Gene specifically for you for only $16.38 $13.9/page Order now We will write a custom essay sample on Phenylalanine hydroxylase (PAH) Gene specifically for you FOR ONLY $16.38 $13.9/page Hire Writer We will write a custom essay sample on Phenylalanine hydroxylase (PAH) Gene specifically for you FOR ONLY $16.38 $13.9/page Hire Writer Phenylalanine hydroxylase (PAH) encodes the liver-secreted enzyme of the same name, a catalyst for the hydroxylation of tyrosine from phenylalanine, a rate-limiting step in the catabolism of the latter. This reaction only occurs in the presence of the cofactor tetrahydrobiopterin (BH4) as well as molecular oxygen and iron (1). Mutations in the PAH gene are generally caused by a change of an amino acid, for example, the change of arginine to tryptophan (2, 3). The numerous possible mutations in this gene result in a lack of enzyme activity. Thus, because of its main function, the deficiency in the activity of PAH causes a marked intolerance of the consumption of phenylalanine, an essential amino acid. This causes phenylketonuria (PKU), non-phenylketonuria hyperphenylalaninemia (non-PKU HPA), mild hyperphenylalaninemia (MHP), and other variant PKU (4, 5, 6). Defects in the PAH gene leads to the deficiency or the disruption of the production of the PAH enzyme; this is most commonly related to the resulting disorder, phenylketonuria. PKU is an autosomal, inborn, recessive disorder of phenylalanine metabolism (7). There are three common types of PKU. First, there is classical PKU, caused by the mutation of both alleles of the PAH gene in chromosome 12 which results in a severe deficiency or complete absence of the PAH enzyme, leading to toxic levels of unhydroxylated phenylalanine, typically over 10 times higher than normal concentrations (i.e. over 1000  µmol compared to the normal 100  µmol). Next, there is MHP, the mildest form of the PAH enzyme deficiency, with phenylalanine levels below 600  µmol but above normal. Thirdly, there is non-PKU HPA, caused by mutations in the PAH locus that hinder BH4 synthesis and regeneration. This relatively milder form of the disorder often results in heterozygous cases through a combination of mi ld and severe mutations (4, 7, 8). Severe classical PKU, if left untreated, is commonly known to result in the impedance of postnatal cognitive development causing mental retardation and in metabolic abnormalities causing increased phenylalanine in in the blood circulation and phenylpyruvic acid in the urine. PKU has also been known to cause skin abnormalities, organ damage, different kinds of posture peculiarities, pregnancy problems (maternal PKU), an odor describe as â€Å"mousy†, as well as other mental issues such as epilepsy, hyperactivity, and psychotic episodes (1,4,7,8). The most common negative effect associated with PKU, mental retardation, is caused by a neurotoxic effect of HPA. And while PKU is an inherited disorder, its negative effects could also be induced in the offspring of mothers with PKU, resulting not only in high fetus mortality rates but also in a high probability that the children are born with growth and mental retardations as well as malformations. This is known as PKU embryofetopath y or maternal PKU syndrome (8). Conversely, children born with non-PKU HPA and MHP have marked lower risks of being affect with the adverse effects of the disorder and can have normal development mentally and physically even with the absence of treatment (4,8). Despite the severe potential effects of classical PKU, newborn screening for high levels of phenylalanine has helped early diagnosis of the disorder, which is then followed by rapid treatment. Dietary restrictions of phenylalanine has been used for early treatment of PKU which, while not necessarily lead to complete normalization of IQ, was shown to be predictive of overall IQ with the complete lack of treatment in classical PKU patients leading to severe and irreversible cognitive retardation.(1,8) Thus, primary screening of neonates and children as well as awareness of the disorder for the parents are essential (3, 6). Results and Discussion: PAH chromosomal map position and nearby genes: The location of the PAH gene is at chromosome 12. Its long arm (q) is comprised of 13 exons with an approximate length of 90 kb. Figure 1 Chromosome 12 (9) Figure 1, above, is a representation of the entire chromosome 12 with both its short arm (p) and long arm (q) as it appears in the Ensembl website, albeit cropped to fit the page. This figure can be found by searching for the PAH gene and clicking on the â€Å"Location† link on the PAH listing. The website lists the location of the gene to be at â€Å"Chromosome 12: 103,232,104-103,311,381 reverse strand.†(2) Though the website does not explicitly state where in chromosome 12 PAH is located, one can infer additional details from the provided images. For example, confusion can ensue from the fact that the indicated location in the image in the Ensembl website is on the long arm on q23.2, while previous sources have stated that it is located on q22-24.2. However, from the code in the location and the additional images, one can infer that these are the transcribed portions of the gene, two of which are illustrated in the site. Furthermore, one can see that the PAH gene is flanked by the genes insulin-like growth factor 1 (IGF1), or somatomedin C, and achaete-scute complex homolog 1 (ASCL1). To obtain the information, though, one needs to explore the interactive image (see Figure 2 below) and go to the individual pages of the neighbor genes. Figure 2 Detailed view of region near PAH (9) The NCBI website, however, while very extensive in details, and containing multiple transcripts pertaining to the PAH gene, can be somewhat confusing with regard to the Map Viewer. Going through the home page and directly searching for the desired gene results in a very large and confusing map, with the details of the gene and its neighboring gene beyond the page to right. For a beginner who is not quite sure what to look for, the NCBI Map Viewer can be very overwhelming. Focusing on the table and not the map, however, one can see that the PAH gene is located in Chromosome 12, in the long arm q22-q24.2; this information is under the heading â€Å"Cyto† (for cytogenic) and stated as â€Å"12q22-q24.2† (10). Again, this might not be immediately clear to a beginner. Furthermore, the different master map options (Morbid, Gene_cyto, etc.) individually show different arrangements of the symbols, not all of which seem to be genes. Thus, it is very hard to decipher which genes are actually near PAH, although zooming in on the â€Å"Genes on Sequence† and â€Å"Phenotype† maps do reveal the proximity of IGF1 and ASCL1. In all, for a beginner, the Ensembl website proved to be much easier to use to answer the first question. The intron/exon structure of the PAH gene: It was very difficult to find an illustration of the structure of the PAH gene in the NCBI website. However, the information page for the gene stated that the gene spans 90 kb with the entire sequence and its adjacent regions a total of 171 kb. Furthermore, it states that the gene contains 13 exons, which consequently means that it has 12 introns (number of introns is one less than the number of exons) (1). After some searching, however, beginning with clicking the available links for PAH in the Map Viewer table, the link â€Å"sv† led to a page with the title â€Å"Homo sapiens chromosome 12 genomic contig, GRCh37 reference primary assembly.† Searching for the gene gives the following (zoomed-in and cropped) structure:   Figure 3 Structure of PAH gene (11) Though not obvious from the first glance, later we will see that the bottom sequence actually represents the structure of the PAH, with the vertical green lines representing the 13 exons. After further searching, the following (rotated) PAH structure showing the 13 exons and 12 introns can be found in the Map Viewer under â€Å"ensRNA†:   Figure 4 Another illustration of the structure of PAH gene (11) Finding those, however, takes previous explicit knowledge and some work to track down the specific illustrations. In contrast, finding the number of exons and introns and an illustration of the structure of the PAH gene in the Ensembl website was very straightforward. The following illustration can be found in the same page as Figure 1: Figure 5 Ensembl illustration of PAH gene structure This strand, one of the transcripts available in the Ensembl page, clearly shows the 13 exons in a DNA sequence. Comparing this structure to Figures 3 and 4, the numbers and the arrangements of the exons and introns are exactly the same. However, relative to all the tedious searching needed to find the same answers in the NCBI website, the information needed for the question was instantly available from the Ensembl site, and the interface was very easy to understand. Common PAH mutations: Mutations in general can refer to abnormalities in function or structure of the concerned enzyme in the gene phenotype. As previously discussed, however, such as the causes of PKU and HPA, the human PAH gene has displayed allelic differences and pathogenic transformations throughout its structure. The common types of mutations and their occurrence according to a previous study are: missense mutations with 62% of the alleles, small or large deletions with 13%, splicing defects with 11%, silent polymorphisms with 6%, nonsense mutations with 5%, and insertions with 2% of the PAH alleles. (6) Table1 PAH mutation statistics Mutation Type: # of Mutation(s) Missense 336 Deletion 73 Splice 62 Silent 32 Nonsense 28 Insertion 10 Sil./Splice 3 Unknown 3 Total mutations: 547 Most reported Mutation (Association): p.R408W (214) Missense, as can be seen above, is the most common cause of mutation in the PAH gene, the molecular mechanism of this is the improper folding of the protein structure, causing aggregation or degradation. As mentioned earlier, the mutations of PAH are commonly caused by single changes in the amino acid. One of the missense mutations, for example, occurs in E1 nucleotide 1 with the change of ATG to GTG. However, there is also missense mutation in region E3 with sequence 187.000 in nucleotide 187; this is called ACC/CCC;CAC/AAC. The second most common type of mutation is deletion. An example of deletion mutation is in regions E2-12 with sequence 168.001 in nucleotide 168. This is called GAG/GAA;G/A and has been noted to have occurred in Palestinians Arabs. (2, 3, 12)   Other examples can be seen in Appendix (I). As mentioned earlier, there are three common variations of PKU: classical PKU, MHP, and non-PKU HPA. These variations which are basically different degrees of severity of the disorder are caused by the different kinds of mutations that cause varying PAH activity as well as allelic variations. The latter effect at the locus of the gene determines the metabolic phenotype of the enzyme deficiency. In general, however, the mutations in the PAH gene are localized in a main part of the gene instead of being randomly distributed, as they occur either within or without the active site. What is interesting to note is that the PAH gene in intron 12 involves the single base change of guanine to adenine in the canonical 5-prime splice donor site where the first identified PKU mutation occurred. (3) Two out of the 6 links given by the Gene Gateway page were no longer working, one was solely dedicated to SNP, one was a link to a database that had links to other databases, and the last two were already explored thoroughly in previous parts of this assignment. The data presented in this section were mostly from the entire site dedicated to PAH gene mutations, the Phenylalanine Hydoxylase Locus Knowledgebase (5). This site, also a database, was arrived at after searching through the Locus Specific Mutation Databases which in turn arrived at from Human Genome Variation Society: Variation Databases and Related Sites. While the OMIM site did give some details about previous studies related to PAH gene mutations, they were more of a history of the mutations and examples of the studies. Finding the needed information was difficult because one needed to go through link after link and website after website, sometimes even arriving at the same website numerous times through different pathwa ys and still not obtaining any results. The PAHdb was by far, the only site that showed any data regarding the common mutations. Single nucleotide polymorphisms (SNPs) of the PAH gene: To date, 1220 SNPs for the PAH gene have been discovered, although GeneCards (2) states only 1097 from the NCBI website. In general, the SNPs involve the changing of a single base, as shown in Appendices I and II. Examples are the three found on exon 3, each of which has a single change of base, name cytocine, thiamine, and adeninine(13). Examples of these PAH gene SNPs are the rs63749677, rs63749676, rs63581460 and rs63499960; some of these are tabulated in Appendix (II). These SNPs are not randomly distributed as out of the 13 exons, they are seen in exons 1-7 and 12. Searching the NCBI website, however, resulted in 55 entries of SNPs with the following format: rs79931499 [Homo sapiens] CAATCCTTTGGGTGTATGGGTCGTAG[C/G]GAACTGAGAAGGGCCGAGGTATTGT 12 The above entry, an example of the results from the query in the NCBI SNP website, shows essential information about the SNP as well as options one can view. Compared to the other related links, which did not yield any useful information other than linking back to this site, the NCBI site dedicated purely to SNPs was simple and the information was easy to retrieve. Due to the very large number of SNPs, however, it would be difficult to evaluate all of them. Designing PCR primers: The given instructions and the program given in the website were rather straightforward, so the designing of the primer was the easiest part of the activity. The mRNA sequence was easily downloadable and the program was user-friendly (14). Being able to design primers this way was very fast and easy. The resulting primers are in Appendix (III). References: 1. [26/08/10]; Available from: http://www.ncbi.nlm.nih.gov/omim/612349 2. Hoeks M, den Heijer M, Janssen M. Adult issues in phenylketonuria. The Netherlands journal of medicine2009;67(1):2. 3. [21/09/09]; Available from: http://www.ensembl.org/index.html. 4. [26/08/10]; Available from: http://www.genecards.org/cgi-bin/carddisp.pl?gene=PAHsearch=pah#loc 5. [26/08/10]; Available from: http://www.pahdb.mcgill.ca. 6. Carter K, Byck S, Waters P, Richards B, Nowacki P, Laframboise R, et al. Mutation at the phenylalanine hydroxylase gene (PAH) and its use to document population genetic variation: the Quebec experience. European Journal of Human Genetics1998;6(1):61-70. 7.   [26/08/10]; Available from: http://www.ncbi.nlm.nih.gov/bookshelf/br.fcgi?book=gndpart=phenylketonuria 8. [26/08/10]; Available from: http://www.ncbi.nlm.nih.gov/bookshelf/br.fcgi?book=genepart=pku 9. [26/08/10]; Available from: http://www.ensembl.org/Homo_sapiens/Location/View?db=core;g=ENSG00000171759;r=12:103232104-103311381;t=ENST00000307000 10. [26/08/10]; Available from: http://www.ncbi.nlm.nih.gov/projects/mapview/maps.cgi?taxid=9606chr=12MAPS=pheno,morbid,genec,decode,ensrna,ensgenes,rnaRn,rnaMm,rnaHs,rnaGga,rnaBt,gbdna,rna,ugHs,genes-rcmd=focusfill=80query=uid(136508683,136446655,12845117,12579049,8990832,717234,698472,11088097,11049717,6481463,570698,568170,34586070,16320694,13572526,34590012,128619463,415205)QSTR=pah 11. [26/08/10]; Available from: http://www.ncbi.nlm.nih.gov/projects/sviewer/?id=NT_029419.12v=65375409..65454686 12. *Robin A Williams, 2 Cyril DS Mamotte,2 *John R Burnett1,3. Phenylketonuria: An Inborn Error of Phenylalanine Metabolism 13.  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚      [updated 21/09/09]; Available from: http://www.ncbi.nlm.nih.gov/SNP/snp_ref.cgi?locusId=5053 14.  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚      [21/09/09]; Available from: http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi Appendices: Appendix (I) Examples 1. Systematic Name: c.1AG Region: E1 Reference (1st): Mutation Name: p.M1V Sequence: 0.000 JOHN SW, ROZEN R, LAFRAMBOISE R, LABERGE C, SCRIVER CR: Novel PKU mutation on haplotype 2 in French-Canadians. Am J Hum Genet 45:905-909, 1989 Other Name: ATG/GTG Length: 1 Nucleotide No.: 1 Rest. Site: -Xba I Mutation Type: Missense Syst. Name gDNA: Date Entered: 1997-01-31 CpG/Fs/Pm: No/No/No 2. Systematic Name: c.3GA Region: E1 EIKEN HG, KNAPPSKOG PM, APOLD J, SKJELKVÃ…LE L, BOMAN H: A de novo phenylketonuria mutation: ATG (Met) to ATA (Ile) in the start codon of the phenylalanine hydroxylase gene. Hum Mut 1:388-391, 1992 Mutation Name: p.M1I Sequence: 3.000 Other Name: ATG/ATA Length: 1 Nucleotide No.: 3 Rest. Site: -NspI Mutation Type: Missense Syst. Name gDNA: Date Entered: 1997-01-31 CpG/Fs/Pm: No/No/No 3. Systematic Name: c.117CG Region: E2 FORREST SM, DAHL HH, HOWELLS DW, DIANZANI I, COTTON RGH: Mutation detection in phenylketonuria by using chemical cleavage of mismatch: Importance of using probes from both normal and patient samples. Am J Hum Genet 49:175-183, 1991 Mutation Name: p.F39L Sequence: 117.000 Other Name: TTC/TTG Length: 1 Nucleotide No.: 117 Rest. Site: -MboII, +MaeIII Mutation Type: Missense Syst. Name gDNA: Erlandsen H, Pey AL, Gà ¡mez A, Pà ©rez B, Desviat LR, Aguado C, Koch R, Surendran S, Tyring S, Matalon R, Scriver CR, Ugarte M, Martà ­nez A, Stevens RC.: Correction of kinetic and stability defects by tetrahydrobiopterin in phenylketonuria patients with certain phenylalanine hydroxylase mutations. Date Entered: 1997-01-31 CpG/Fs/Pm: No/No/No Appendix (II) SNPs of the PAH gene Region Contig position mRNA pos dbSNP rs# cluster id Hetero- zygosity Function dbSNP allele Protein residue Codon pos Amino acid pos exon_12 26716405 1750 rs59326968 N.D. synonymous C Asn [N] 3 426 contig reference T Asn [N] 3 426 exon_7 26728783 1314 rs5030851 N.D. missense T Leu [L] 2 281 contig reference C Pro [P] 2 281 exon_6 26731200 1061 rs5030653 N.D. missense (22bp) [CIKPMLAN] 1 197 frame shift -/TGTATAAAACCCATGCTTGCTA 1 197 contig reference (22bp) [LYKTHACY] 1 197 26731262 1020 rs17852373 N.D. missense G Gly [G] 2 183 contig reference A Glu [E] 2 183 exon_3 26770856 671 rs5030842 N.D. missense C Pro [P] 1 67 contig reference T Ser [S] 1 67 contig reference A Ser [S] 3 36 exon_1 26793098 474 start codon 1 Appendix (III) Designed Primers Exon1 ENSE00001141448 CAGCTGGGGGTAAGGGGGGCGGATTATTCATATAATTGTTATACCAGACGGTCGCAGGCT TAGTCCAATTGCAGAGAACTCGCTTCCCAGGCTTCTGAGAGTCCCGGAAGTGCCTAAACC TGTCTAATCGACGGGGCTTGGGTGGCCCGTCGCTCCCTGGCTTCTTCCCTTTACCCAGGG CGGGCAGCGAAGTGGTGCCTCCTGCGTCCCCCACACCCTCCCTCAGCCCCTCCCCTCCGG CCCGTCCTGGGCAGGTGACCTGGAGCATCCGGCAGGCTGCCCTGGCCTCCTGCGTCAGGA CAACGCCCACGAGGGGCGTTACTGTGCGGAGATGCACCACGCAAGAGACACCCTTTGTAA CTCTCTTCTCCTCCCTAGTGCGAGGTTAAAACCTTCAGCCCCACGTGCTGTTTGCAAACC TGCCTGTACCTGAGGCCCTAAAAAGCCAGAGACCTCACTCCCGGGGAGCCAGCATGTCCA CTGCGGTCCTGGAAAACCCAGGCTTGGGCAGGAAACTCTCTGACTTTGGACAG PCR primer design: No mispriming library specified Using 1-based sequence positions OLIGO  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚     Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  start   Ã‚  len   Ã‚  Ã‚  tm   Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  gc%   Ã‚  any     Ã‚  3  Ã‚  Ã‚  Ã‚  Ã‚     seq LEFT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚     Ã‚  369  Ã‚   20  Ã‚   59.83  Ã‚   55.00   6.00   2.00   Ã‚  TCCTCCCTAGTGCGAGGTTA RIGHT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚     522  Ã‚   20  Ã‚   59.98  Ã‚   55.00   3.00   2.00   Ã‚  CAGAGAGTTTCCTGCCCAAG SEQUENCE SIZE: 533 INCLUDED REGION SIZE: 533 PRODUCT SIZE: 154, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 3.00 1 CAGCTGGGGGTAAGGGGGGCGGATTATTCATATAATTGTTATACCAGACGGTCGCAGGCT 61 TAGTCCAATTGCAGAGAACTCGCTTCCCAGGCTTCTGAGAGTCCCGGAAGTGCCTAAACC 121 TGTCTAATCGACGGGGCTTGGGTGGCCCGTCGCTCCCTGGCTTCTTCCCTTTACCCAGGG 181 CGGGCAGCGAAGTGGTGCCTCCTGCGTCCCCCACACCCTCCCTCAGCCCCTCCCCTCCGG 241 CCCGTCCTGGGCAGGTGACCTGGAGCATCCGGCAGGCTGCCCTGGCCTCCTGCGTCAGGA 301 CAACGCCCACGAGGGGCGTTACTGTGCGGAGATGCACCACGCAAGAGACACCCTTTGTAA 361 CTCTCTTCTCCTCCCTAGTGCGAGGTTAAAACCTTCAGCCCCACGTGCTGTTTGCAAACC 421 TGCCTGTACCTGAGGCCCTAAAAAGCCAGAGACCTCACTCCCGGGGAGCCAGCATGTCCA 481 CTGCGGTCCTGGAAAACCCAGGCTTGGGCAGGAAACTCTCTGACTTTGGACAG KEYS (in order of precedence): left primer right primer ADDITIONAL OLIGOS start   Ã‚  len   Ã‚  Ã‚  tm   Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  gc%   Ã‚  any     Ã‚  Ã‚  Ã‚  3  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚     seq 1 LEFT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚     Ã‚  Ã‚  339  Ã‚   20  Ã‚   59.77  Ã‚   50.00   Ã‚  3.00   Ã‚  1.00  Ã‚  Ã‚     ACGCAAGAGACACCCTTTGT RIGHT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   522  Ã‚   20  Ã‚   59.98  Ã‚   55.00   Ã‚  3.00   Ã‚  2.00   Ã‚  Ã‚  Ã‚  Ã‚  CAGAGAGTTTCCTGCCCAAG PRODUCT SIZE: 184, PAIR ANY COMPL: 6.00, PAIR 3 COMPL: 2.00 2 LEFT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   318  Ã‚   20  Ã‚   59.32  Ã‚   55.00   4.00   2.00 GTTACTGTGCGGAGATGCAC RIGHT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   522  Ã‚   20  Ã‚   59.98  Ã‚   55.00   3.00   2.00 CAGAGAGTTTCCTGCCCAAG PRODUCT SIZE: 205, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 2.00 3 LEFT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   157  Ã‚   20  Ã‚   60.07  Ã‚   55.00   2.00   0.00 CTGGCTTCTTCCCTTTACCC RIGHT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   337  Ã‚   20  Ã‚   59.32  Ã‚   55.00   4.00   3.00 GTGCATCTCCGCACAGTAAC PRODUCT SIZE: 181, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 1.00 4 LEFT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   156  Ã‚   20  Ã‚   60.07  Ã‚   55.00   3.00   0.00 CCTGGCTTCTTCCCTTTACC RIGHT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   337  Ã‚   20  Ã‚   59.32  Ã‚   55.00   4.00   3.00 GTGCATCTCCGCACAGTAAC PRODUCT SIZE: 182, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 2.00 Statistics con  Ã‚   too  Ã‚  Ã‚   in  Ã‚  Ã‚   in  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   no  Ã‚  Ã‚   tm  Ã‚  Ã‚   tm   high   high  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   high sid   many  Ã‚   tar   excl  Ã‚   bad  Ã‚  Ã‚   GC  Ã‚   too  Ã‚   too  Ã‚   any  Ã‚  Ã‚   3   poly  Ã‚   end ered  Ã‚  Ã‚   Ns  Ã‚   get  Ã‚   reg  Ã‚   GC% clamp  Ã‚   low   high compl compl  Ã‚  Ã‚  Ã‚   X   stab  Ã‚  Ã‚   ok Left  Ã‚  Ã‚   3637  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   0  Ã‚   162  Ã‚  Ã‚  Ã‚   0  Ã‚   419   2558  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   2  Ã‚  Ã‚   22  Ã‚  Ã‚   73  Ã‚   401 Right  Ã‚   3701  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   0  Ã‚   130  Ã‚  Ã‚  Ã‚   0  Ã‚   321   2817  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   2  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚   78  Ã‚   353 Pair Stats: considered 140, unacceptable product size 129, high end compl 3, ok 8 primer3 release 1.1.4 KEYS (in order of precedence): left primer right primer ADDITIONAL OLIGOS start   Ã‚  len   Ã‚  Ã‚  tm   Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  gc%   Ã‚  any     Ã‚  3  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚     seq 1 LEFT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   19  Ã‚   20  Ã‚   60.21  Ã‚   50.00   5.00   2.00   Ã‚  Ã‚  Ã‚  GCAGTGCCCTCCAGAAAATA RIGHT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   265  Ã‚   20  Ã‚   58.12  Ã‚   40.00   3.00   0.00   Ã‚  TCAAAGATGACCCCAAAAGA PRODUCT SIZE: 247, PAIR ANY COMPL: 2.00, PAIR 3 COMPL: 0.00 2 LEFT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   19  Ã‚   20  Ã‚   60.21  Ã‚   50.00   5.00   2.00  Ã‚     GCAGTGCCCTCCAGAAAATA RIGHT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   260  Ã‚   22  Ã‚   60.05  Ã‚   40.91   4.00   0.00   Ã‚  GATGACCCCAAAAGATTTACCA PRODUCT SIZE: 242, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 1.00 3 LEFT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   45  Ã‚   20  Ã‚   60.39  Ã‚   50.00   6.00   1.00  Ã‚     AGCCATGGACAGAATGTGGT RIGHT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   265  Ã‚   20  Ã‚   58.12  Ã‚   40.00   3.00   0.00   Ã‚  TCAAAGATGACCCCAAAAGA PRODUCT SIZE: 221, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 1.00 4 LEFT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   19  Ã‚   20  Ã‚   60.21  Ã‚   50.00   5.00   2.00   Ã‚  Ã‚  Ã‚  GCAGTGCCCTCCAGAAAATA RIGHT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   258  Ã‚   20  Ã‚   57.92  Ã‚   40.00   4.00   0.00   Ã‚  TGACCCCAAAAGATTTACCA PRODUCT SIZE: 240, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 1.00 Statistics con  Ã‚   too  Ã‚  Ã‚   in  Ã‚  Ã‚   in  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   no  Ã‚  Ã‚   tm  Ã‚  Ã‚   tm   high   high  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   high sid   many  Ã‚   tar   excl  Ã‚   bad  Ã‚  Ã‚   GC  Ã‚   too  Ã‚   too  Ã‚   any  Ã‚  Ã‚   3   poly  Ã‚   end ered  Ã‚  Ã‚   Ns  Ã‚   get  Ã‚   reg  Ã‚   GC% clamp  Ã‚   low   high compl compl  Ã‚  Ã‚  Ã‚   X   stab  Ã‚  Ã‚   ok Left     Ã‚  7708  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   0  Ã‚   791  Ã‚  Ã‚  Ã‚   0   4562  Ã‚   600  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚   14  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚   52   1689 Right  Ã‚   7734  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   0   1269  Ã‚  Ã‚  Ã‚   0   4609  Ã‚   311  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   6  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚   44   1495 Pair Stats: considered 2222, unacceptable product size 2195, high end compl 6, ok 21 primer3 release 1.1.4

Tuesday, November 26, 2019

John H. Ostrom - A Profile of the Famous Paleontologist

John H. Ostrom - A Profile of the Famous Paleontologist Name: John H. Ostrom Born/Died: 1928-2005 Nationality: American Dinosaurs Discovered or Named: Deinonychus, Sauropelta, Tenontosaurus, Microvenator About John H. Ostrom Nowadays, pretty much all paleontologists agree that birds descended from dinosaurs. However, that wasn’t the case in the 1960s, when John H. Ostrom of Yale University was the first researcher to propose that dinosaurs had more in common with ostriches and swallows than with snakes, turtles and alligators (to be fair, the heavyweight American  paleontologist Othniel C. Marsh, who also taught at Yale, had proposed this idea in the late 19th century, but he didnt have enough evidence at his disposal to carry the weight of scientific opinion). Ostroms theory about the dinosaur-bird evolutionary link was inspired by his 1964 discovery of Deinonychus, a large, bipedal raptor that displayed some uncannily birdlike characteristics. Today, its (pretty much) an established fact that Deinonychus and its fellow raptors were covered with feathers, not a popular image a generation ago, and one that even current dinosaur enthusiasts have difficulty accepting. (In case you were wondering, those Velociraptors in Jurassic Park were really modeled after the  much bigger  Deinonychus, disregarding the fact that they were portrayed with green reptilian skin rather than feathers.) Fortunately for him, Ostrom lived long enough to learn about the trove of indisputably feathered dinosaurs recently discovered in China, which cemented the dinosaur-bird connection. When he discovered Deinonychus, Ostrom opened the dinosaur equivalent of a hornets nest. Paleontologists werent used to dealing with muscular, man-sized, predatory dinosaursas opposed to familiar, multi-ton carnivores like Allosaurus or Tyrannosaurus Rexwhich prompted speculation about whether an ostensibly cold-blooded reptile could engage in such energetic behavior. In fact, Ostroms student Robert Bakker was the first paleontologist to forcefully propose that all theropod dinosaurs were warm-blooded, a theory thats currently on only slightly shakier ground than the dinosaur-bird connection. ​By the way, he wasnt responsible for either discovering or naming this dinosaur, but the type species of Utahraptor (U. ostrommaysorum) was named after John Ostrom and Chris Mays, a pioneer in animatronic dinosaurs.

Friday, November 22, 2019

Gustar Conjugation in Spanish, Translation, and Examples

Gustar Conjugation in Spanish, Translation, and Examples The Spanish verb gustar can be translated as to like. This verb may be confusing for Spanish learners because gustar is considered a defective or impersonal verb, so it is often conjugated in the third person only. In addition, it requires a variation in the sentence structure. This article includes gustar conjugations in the indicative mood (present, past, conditional, and future), the subjunctive mood (present and past), the imperative mood, and other verb forms, as well as examples, translations, and explanations of the peculiarities of the verb gustar. Using the Verb Gustar If youre a beginner at Spanish, chances are most of the sentences youve been using as examples follow roughly the same word order as we use in English, with the verb following the subject. But Spanish also frequently places the subject after the verb, and that is usually true with gustar. Here are some examples of gustar in action: Me gusta el coche. (I like the car.)Nos gustan los coches. (We like the cars.)Le gustan los coches. (You/he/she likes the cars.) As you can see, the sentences arent quite what you might expect. Instead of following the form person who likes verb the object liked, they follow the form indirect-object pronoun representing the person who likes verb the object liked (the indirect-object pronouns are me, te, le, nos, os, and les). In these sentences, the object liked is the subject in Spanish. Also, note that the subject of these sentences (the object that is liked) is always accompanied by the definite article (el, la, los, las). If this seems confusing, heres an approach that might help: Instead of thinking of gustar as meaning to like, it is both more accurate and makes more sense in this sentence structure to think of it as meaning to be pleasing. When we say, I like the car, the meaning is much the same as saying, the car is pleasing to me. In plural form, it becomes the cars are pleasing to me, with a plural verb. Note, then, the differences in the common and literal translations below: Me gusta el coche.  (I like the car. Literally, the car is pleasing to me.)Nos gustan los coches. (We like the cars. Literally, the cars are pleasing to us.)Le gustan las camionetas. (You /he/she likes the pickups. Literally, the pickups are pleasing to you/him/her.) When the pronoun le or les is used, as in the third example, the context might not always make clear who is the person doing the liking. In that case, you can add the prepositional phrase a the person liking, as shown below, at the beginning of the sentence (or less commonly at the end of the sentence). Note that the indirect-object pronoun cannot be omitted; the prepositional phrase clarifies the indirect-object pronoun rather than replacing it. A Carlos le gusta el coche. (Carlos likes the car.)A Marà ­a le gustan las camionetas. (Marà ­a likes the pickups.) ¿A ustedes les gusta el coche? (Do you like the car?) Conjugating Gustar Because gustar is nearly always used with subjects in the third person, it is often considered a defective verb. However, it can also be used with other subjects to talk about liking different people. Be careful though, because often the verb gustar, when used with people, denotes a romantic attraction. To talk about simply liking people, a more common expression uses the verb caer bien, as in Marà ­a me cae bien (I like Marà ­a). In the table below, you can see how gustar can be conjugated for each different subject using this romantic meaning. Yo gusto Yo le gusto a mi novio. My boyfriend likes me. / I am pleasing to my boyfriend. Tà º gustas Tà º le gustas a tu esposa. Your wife likes you. / You are pleasing to your wife. Usted/à ©l/ella gusta Ella le gusta a Carlos. Carlos likes her. / She is pleasing to Carlos. Nosotros gustamos Nosotros le gustamos a muchas personas. Many people like us. / We are pleasing to many people. Vosotros gustis Vosotros le gustis a Pedro. Pedro likes you. / You are pleasing to Pedro. Ustedes/ellos/ellas gustan Ellos le gustan a Marta. Marta likes them. / They are pleasing to Marta. Since gustar is frequently used to talk about things being pleasing to people, or people liking things, the tables below show the conjugations of the verb with the liked objects as the subject of the sentence. The verb takes the form of the third person singular if the person likes a singular noun or verb, and the third person plural if the person likes a plural noun. Gustar Present Indicative A mà ­ me gusta(n) Me gusta la comida china. I like Chinese food. A ti tegusta(n) Te gustan las frutas y verduras. You like fruits and vegetables. A usted/à ©l/ella legusta(n) Le gusta bailar salsa. She likes to dance salsa. A nosotros nosgusta(n) Nos gusta el arte moderno. We like modern art. A vosotros osgusta(n) Os gusta caminar por la ciudad. You like walking around the city. A ustedes/ellos/ellas lesgusta(n) Les gustan los colores vivos. They like bright colors. Preterite Indicative The preterite tense is used to talk about completed actions in the past. In the case of gustar, it would be used in the context of seeing or trying something for the first time and liking it, or having liked something only for a certain amount of time. A mà ­ me gustà ³/gustaron Me gustà ³ la comida china. I liked Chinese food. A ti tegustà ³/gustaron Te gustaron las frutas y verduras. You liked fruits and vegetables. A usted/à ©l/ella legustà ³/gustaron Le gustà ³ bailar salsa. She liked to dance salsa. A nosotros nosgustà ³/gustaron Nos gustà ³ el arte moderno. We liked modern art. A vosotros osgustà ³/gustaron Os gustà ³ caminar por la ciudad. You liked walking around the city. A ustedes/ellos/ellas lesgustà ³/gustaron Les gustaron los colores vivos. They liked bright colors. Imperfect Indicative The imperfect tense is used to talk about ongoing or repeated actions in the past. In the case of gustar, it would refer to someone who used to like something, but doesnt anymore. A mà ­ me gustaba(n) Me gustabala comida china. I used to like Chinese food. A ti tegustaba(n) Te gustabanlas frutas y verduras. You used to like fruits and vegetables. A usted/à ©l/ella legustaba(n) Le gustababailar salsa. She used to like to dance salsa. A nosotros nosgustaba(n) Nos gustabael arte moderno. We used to like modern art. A vosotros osgustaba(n) Os gustabacaminar por la ciudad. You used to likewalking around the city. A ustedes/ellos/ellas lesgustaba(n) Les gustaban los colores vivos. Theyused to like bright colors. Future Indicative A mà ­ me gustar(n) Me gustarla comida china. I will like Chinese food. A ti tegustar(n) Te gustarnlas frutas y verduras. You will like fruits and vegetables. A usted/à ©l/ella legustar(n) Le gustarbailar salsa. She will like to dance salsa. A nosotros nosgustar(n) Nos gustarel arte moderno. We will like modern art. A vosotros osgustar(n) Os gustarcaminar por la ciudad. You will likewalking around the city. A ustedes/ellos/ellas lesgustar(n) Les gustarn los colores vivos. Theywill like bright colors. Periphrastic  Future Indicative   A mà ­ me va(n) a gustar Me va a gustar la comida china. I am going to like Chinese food. A ti teva(n) a gustar Te van a gustarlas frutas y verduras. You aregoing to like fruits and vegetables. A usted/à ©l/ella leva(n) a gustar Le va a gustarbailar salsa. She isgoing to like to dance salsa. A nosotros nosva(n) a gustar Nos va a gustarel arte moderno. We aregoing to like modern art. A vosotros osva(n) a gustar Os va a gustarcaminar por la ciudad. You aregoing to likewalking around the city. A ustedes/ellos/ellas lesva(n) a gustar Les van a gustar los colores vivos. Theyaregoing to like bright colors. Present Progressive/Gerund Form The gerund or present participle can be used as an adverb, or to form progressive tenses like the present progressive. Present Progressive ofGustar est(n) gustando A ella le est gustando bailar salsa. She is liking dancing salsa. Past Participle The past participle can be used as an adjective or to form compound verb forms using the auxiliary verb haber, such as the present perfect. Present Perfect of Gustar ha(n) gustado A ella le ha gustado bailar salsa. She has liked dancing salsa. Conditional Indicative The conditional tense is used to talk about possibilities. A mà ­ me gustarà ­a(n) Me gustarà ­ala comida china, pero es muy salada. I would like Chinese food, but it is very salty. A ti tegustarà ­a(n) Te gustarà ­anlas frutas y verduras si fueras ms saludable. You would like fruits and vegetables if you were healthier. A usted/à ©l/ella legustarà ­a(n) Le gustarà ­abailar salsa si hubiera tomado clases. She would like to dance salsa if she had taken lessons. A nosotros nosgustarà ­a(n) Nos gustarà ­ael arte moderno, pero preferimos el arte clsico. We would like modern art, but we prefer classical art. A vosotros osgustarà ­a(n) Os gustarà ­acaminar por la ciudad si no fuera peligroso. You would likewalking around the city if it were not dangerous. A ustedes/ellos/ellas lesgustarà ­a(n) Les gustarà ­an los colores vivos, pero prefieren los colores claros. Theywould like bright colors, but they prefer light colors. Present Subjunctive Que a mà ­ me guste(n) El cocinero espera que me guste la comida china. The cook hopes I like Chinese food. Que a ti te guste(n) Tu madre espera que te gusten las frutas y verduras. Your mother hopes that you like fruits and vegetables. Que a usted/à ©l/ella le guste(n) Su novio espera que a ella le guste bailar salsa. Her boyfriend hopes that she like to dance salsa. Que a nosotros nos guste(n) El artista espera que nos guste el arte moderno. The artist hopes that we like modern art. Que a vosotros os guste(n) La doctora espera que nos guste caminar por la ciudad. The doctor hopes that we like walking around the city. Que a ustedes/ellos/ellas les guste(n) El diseà ±ador espera que a ellas les gusten los colores vivos. The designer hopes that they like bright colors. Imperfect Subjunctive The imperfect subjunctive can be conjugated in two different ways: Option 1 Que a mà ­ me gustara(n) El cocinero esperaba que me gustara la comida china. The cook hoped I like Chinese food. Que a ti te gustara(n) Tu madre esperaba que te gustaran las frutas y verduras. Your mother hoped that you like fruits and vegetables. Que a usted/à ©l/ella le gustara(n) Su novio esperaba que a ella le gustara bailar salsa. Her boyfriend hoped that she like to dance salsa. Que a nosotros nos gustara(n) El artista esperaba que nos gustara el arte moderno. The artist hoped that we like modern art. Que a vosotros os gustara(n) La doctora esperaba que nos gustara caminar por la ciudad. The doctor hoped that we like walking around the city. Que a ustedes/ellos/ellas les gustara(n) El diseà ±ador esperaba que les gustaran los colores vivos. The designer hoped that they like bright colors. Option 2 Que a mà ­ me gustase(n) El cocinero esperaba que me gustase la comida china. The cook hoped I like Chinese food. Que a ti te gustase(n) Tu madre esperaba que te gustasen las frutas y verduras. Your mother hoped that you like fruits and vegetables. Que a usted/à ©l/ella le gustase(n) Su novio esperaba que a ella le gustase bailar salsa. Her boyfriend hoped that she like to dance salsa. Que a nosotros nos gustase(n) El artista esperaba que nos gustase el arte moderno. The artist hoped that we like modern art. Que a vosotros os gustase(n) La doctora esperaba que nos gustase caminar por la ciudad. The doctor hoped that we like walking around the city. Que a ustedes/ellos/ellas les gustase(n) El diseà ±ador esperaba que les gustasen los colores vivos. The designer hoped that they like bright colors. Gustar Imperative The imperative mood is used to give commands or orders. However, remember that gustar is a different verb, where the subject of the sentence is the object that pleases the person. Since you cant command a thing to please someone, the imperative forms of gustar are very rarely used. If you wanted to tell someone to like something, you would say it in a more indirect way using a structure with the subjunctive, such as Quiero que te gusten las frutas (I want you to like fruit) or Exijo que te guste bailar (I demand that you like to dance).

Thursday, November 21, 2019

Managing Communication Coursework Example | Topics and Well Written Essays - 750 words

Managing Communication - Coursework Example SOK – Fitness is not an exception when it comes to appropriate management of information as it is the verge of remaining competitive and relevant in the market2. Members of the marketing team in SOK – Fitness come across a wide range of date in their daily operations most of which are significant for effective decision making in areas of improving the image and publicity of the Fitness Center. The information that gets at the disposal of the marketing team is highly concerned with the financial and sales aspects of the Fitness Center. Information and knowledge is collected from the both internal and external sources. Internal data is collected through everyday interaction with the customers. For instance, the marketing team derives a wide range of information from the visit reports by the sales personnel, received and delivered orders, return inwards, customer enquiries, sales invoices, and recorded costs3. Marketers’ interaction with the clients provides a vital source of secondary information which can be used for marketing research. A wide range of information is also collected from the external sources which include but not limited to Government statistics, Trade associations, Commercial services, National and international institutions. Most of the information gathered from external sources does not directly reflect the affairs and business processes of the organizations4. However, they portray an aggregate data about the affairs of the entire industry. Such information is considered relevant because it is gathered from various operators in the fitness center and as such they are highly valuable market research purposes5. Before information is formatted in SOK – Fitness it is first categorized into whether it should be structured or unstructured. Structured information refers to information which should formatted using specified rules and guidelines for precision and formality while unstructured information does not require rule s and guidelines when being formatted. Unstructured data will be used for unstructured decisions while the structured information shall be used for structured decisions6. Another important point to consider when formatting information in the Fitness Center is the scope and frequency of use. Computer system will be used for formatting the information gathered from various sources that is both internal and external sources. Management information systems, Expert Systems and Decision Support Systems will be used for formatting and procession of the data gathered from internal and external sources for a highly intelligible information that would ease decision making process. Already formatted information will be stored in secondary storage devices such as computer hard disks and the compact disks for future utilization7. Marketing team in the SOK – Fitness are relying on the easiest way of storing information gathered from various sources as well as the already formatted informat ion in computer hard disk and compact disks as this does not involve exorbitant spending on storage of information. The choice of a storage facility will have an impact on the effectiveness on the data in future. A wrong choice will translate to significant damages on data stored8. The stored information

Tuesday, November 19, 2019

Changing Employee Benefits at Longos Assignment Example | Topics and Well Written Essays - 250 words

Changing Employee Benefits at Longos - Assignment Example its in that by getting onboard the personnel to aid in designing the benefits scheme, they will feel rejuvenated and appreciated hence will fulfill their roles with new found passion and drive thus enabling the company realize new client markets and enhanced revenue precincts as a consequence of the extra input involved. When compared and to the recommendations in chapter eight, Longos approach to employee benefits was a very bold move given the challenges they experienced such as speaking of diverse languages and bringing together a workforce of approximately 2000 people to read from the same script. (McGraw-Hill Ryerson Videos, 2011) But through proper planning and involving the teams they were in a position to pull it off, and the personnel were content with the upshot of the rebranding of their benefits. Longos should always try and conduct trainings and create awareness for the employees so that they understand their benefits. It could be improved by conducting workshops and taking part in team building

Saturday, November 16, 2019

Death Penalty Essay Example for Free

Death Penalty Essay Should be Abolished from our Judicial System Fagan, Jeffrey A. Capital Punishment: Deterrent Effects Capital Costs. www. law. columbia. edu/law-school/communications/reports. Summer 2006. Web. 06 April 2011. The article shows that the states are broken, and the money that we are spending on trials to punish criminals to death penalty should be used in prevention. If you compare the costs of the process and the effects, USA should abolish the death penalty from our Judicial System. It is an excellent article, with detailed information and written y someone who has done many research about capital punishment. It will be very helpful to back up my thesis. Stamper, Norm. A Former Cop Speaks out Against the Death Penalty. www. deathpenalty. org/article. php. 17 Nov 2007. Web 04/02/2011. The article describes an experience of a former cop, who worked for 29 years at San Diego Police Department. In his opinion death penalty is a waste of money, and fails terribly to reduce crime. He feels like we are better off spending the money and resources on programs such as mental health care, drugs and alcohol treatment, after school programs and education. The article is very interesting and comes from a reliable source. He makes very good points on why we should abolish the death penalty. Death Penalty Information Center: Facts about the Death Penalty. www. deathpenaltyinfo. org. 1 April 2011. Web 04/04/2011 This is a complete and updated article about death penalty. It shows all the details and statistics about the number of defendants who were executed and their race, number of victims in death penalty cases and their races, and number of death row exonerations by state. Definitely, I will use this article on my essay because the information will ake my argument stronger, and it comes from a reliable source. Bedau, Hugo, and Paul Cassel. Debate the Death Penalty: Should America Have Capital Punishment? The experts on Both Sides Make Their Best Case. New York: Oxford University Press 2004. In this book, the author and other experts debate several questions about death penalty. It provides insights on advantages and disadvantages of death penalty, and opinions come from people with different ways of thinking. This book will be helpful because it has credible information, and the author is an expert on the subject of death penalty. Some chapter will serve as a counter argument to my thesis. Amnesty USA. Death Penalty and Innocence. http://www. amnestyusa. org/deathpenalty-facts/death-penalty-and-innocence. Web. 04 April 2011. The article shows how the governor, George Ryan, of Illinois feels about the death penalty. He can not support it because the system is full of errors and he is not sure that everyone sent to death row is guilt. He does not want to see the state taking an innocent life. The article is full of good information, with facts, and many details about the number of innocent people that has been released from death row. The article will be helpful because it is based on statistics, data, and full of facts. Folduary, Fred. Abolish the Death Penalty. Editorial. The Progress Report. 2000 www. progress. org. Web. 04 April 2011. The article shows that there are four justifications for capital punishment: protection of society, reform and rehabilitate the criminal, deterrence, restitution of the damage. Punishing the criminal to death penalty will not solve any of these problems. It is a well written article, based on researches and statistics. To make my essay stronger, with valid points, I will use some quotations from this article.

Thursday, November 14, 2019

Life in a Small Village in Greece :: essays papers

Life in a Small Village in Greece This paper is based upon the biography of a couple that is living in Playiari, which is a village 25 km from Thessaloniki, Greece. The couple is three years married, after being four years engaged, and now they are living at a house of their own. They do not have any children, so far, but they have a dog whose name is Lambros. Their names are Tasos and Efi. He is the owner of a cafà © and she is working at a branch of an insurance company. I met them almost six years ago when I got hired by Tasos as a waiter in his cafà ©, and I chose them for my paper because first of all I feel really comfortable with them and second because they are young so the research that is going to be done to be more vivid and up to date. What is going to be presented in this paper are the various information that I have obtained from them, for several aspects of their lives. Furthermore, what is to be accomplished is the comparison of their lives with those of their grandparents and alongside with this the comparison and contrast of these information with the ones in the articles that were covered in class. Firstly what is to be conferred are information about Tasos family. Tasos family originated from Kallipoli which was a suburb of Constantinople (Instanbul). They were living there before the destruction of Asia Minor and the exchange of population between Greece and Turkey taking place. When the exchange of the populations took place his grandfather moved straight to Playiari, which basically is a village composed of immigrants who came from there and at that point in time was nothing but a complex of 4-5 houses. Their residents were locals, who had conflicts with the incoming people, because they did not want others to claim land in that territory. Finally most of the immigrants got to claim and own a piece of land. Tasos was born 32 years ago in Edessa, a city close to Thessaloniki. When he was two years old his family moved in a village, which was located in the district(nomos) Pelas and it is called St.George. They remained there for about nine years, until Tasos became 1 1 years old, and after that they moved to Lakoma, a village in Halkidiki. Life in a Small Village in Greece :: essays papers Life in a Small Village in Greece This paper is based upon the biography of a couple that is living in Playiari, which is a village 25 km from Thessaloniki, Greece. The couple is three years married, after being four years engaged, and now they are living at a house of their own. They do not have any children, so far, but they have a dog whose name is Lambros. Their names are Tasos and Efi. He is the owner of a cafà © and she is working at a branch of an insurance company. I met them almost six years ago when I got hired by Tasos as a waiter in his cafà ©, and I chose them for my paper because first of all I feel really comfortable with them and second because they are young so the research that is going to be done to be more vivid and up to date. What is going to be presented in this paper are the various information that I have obtained from them, for several aspects of their lives. Furthermore, what is to be accomplished is the comparison of their lives with those of their grandparents and alongside with this the comparison and contrast of these information with the ones in the articles that were covered in class. Firstly what is to be conferred are information about Tasos family. Tasos family originated from Kallipoli which was a suburb of Constantinople (Instanbul). They were living there before the destruction of Asia Minor and the exchange of population between Greece and Turkey taking place. When the exchange of the populations took place his grandfather moved straight to Playiari, which basically is a village composed of immigrants who came from there and at that point in time was nothing but a complex of 4-5 houses. Their residents were locals, who had conflicts with the incoming people, because they did not want others to claim land in that territory. Finally most of the immigrants got to claim and own a piece of land. Tasos was born 32 years ago in Edessa, a city close to Thessaloniki. When he was two years old his family moved in a village, which was located in the district(nomos) Pelas and it is called St.George. They remained there for about nine years, until Tasos became 1 1 years old, and after that they moved to Lakoma, a village in Halkidiki.