Saturday, November 30, 2019
Phenylalanine hydroxylase (PAH) Gene Essay Example
Phenylalanine hydroxylase (PAH) Gene Paper Phenylalanine hydroxylase (PAH) Gene Background: We will write a custom essay sample on Phenylalanine hydroxylase (PAH) Gene specifically for you for only $16.38 $13.9/page Order now We will write a custom essay sample on Phenylalanine hydroxylase (PAH) Gene specifically for you FOR ONLY $16.38 $13.9/page Hire Writer We will write a custom essay sample on Phenylalanine hydroxylase (PAH) Gene specifically for you FOR ONLY $16.38 $13.9/page Hire Writer Phenylalanine hydroxylase (PAH) encodes the liver-secreted enzyme of the same name, a catalyst for the hydroxylation of tyrosine from phenylalanine, a rate-limiting step in the catabolism of the latter. This reaction only occurs in the presence of the cofactor tetrahydrobiopterin (BH4) as well as molecular oxygen and iron (1). Mutations in the PAH gene are generally caused by a change of an amino acid, for example, the change of arginine to tryptophan (2, 3). The numerous possible mutations in this gene result in a lack of enzyme activity. Thus, because of its main function, the deficiency in the activity of PAH causes a marked intolerance of the consumption of phenylalanine, an essential amino acid. This causes phenylketonuria (PKU), non-phenylketonuria hyperphenylalaninemia (non-PKU HPA), mild hyperphenylalaninemia (MHP), and other variant PKU (4, 5, 6). Defects in the PAH gene leads to the deficiency or the disruption of the production of the PAH enzyme; this is most commonly related to the resulting disorder, phenylketonuria. PKU is an autosomal, inborn, recessive disorder of phenylalanine metabolism (7). There are three common types of PKU. First, there is classical PKU, caused by the mutation of both alleles of the PAH gene in chromosome 12 which results in a severe deficiency or complete absence of the PAH enzyme, leading to toxic levels of unhydroxylated phenylalanine, typically over 10 times higher than normal concentrations (i.e. over 1000 à µmol compared to the normal 100 à µmol). Next, there is MHP, the mildest form of the PAH enzyme deficiency, with phenylalanine levels below 600 à µmol but above normal. Thirdly, there is non-PKU HPA, caused by mutations in the PAH locus that hinder BH4 synthesis and regeneration. This relatively milder form of the disorder often results in heterozygous cases through a combination of mi ld and severe mutations (4, 7, 8). Severe classical PKU, if left untreated, is commonly known to result in the impedance of postnatal cognitive development causing mental retardation and in metabolic abnormalities causing increased phenylalanine in in the blood circulation and phenylpyruvic acid in the urine. PKU has also been known to cause skin abnormalities, organ damage, different kinds of posture peculiarities, pregnancy problems (maternal PKU), an odor describe as ââ¬Å"mousyâ⬠, as well as other mental issues such as epilepsy, hyperactivity, and psychotic episodes (1,4,7,8). The most common negative effect associated with PKU, mental retardation, is caused by a neurotoxic effect of HPA. And while PKU is an inherited disorder, its negative effects could also be induced in the offspring of mothers with PKU, resulting not only in high fetus mortality rates but also in a high probability that the children are born with growth and mental retardations as well as malformations. This is known as PKU embryofetopath y or maternal PKU syndrome (8). Conversely, children born with non-PKU HPA and MHP have marked lower risks of being affect with the adverse effects of the disorder and can have normal development mentally and physically even with the absence of treatment (4,8). Despite the severe potential effects of classical PKU, newborn screening for high levels of phenylalanine has helped early diagnosis of the disorder, which is then followed by rapid treatment. Dietary restrictions of phenylalanine has been used for early treatment of PKU which, while not necessarily lead to complete normalization of IQ, was shown to be predictive of overall IQ with the complete lack of treatment in classical PKU patients leading to severe and irreversible cognitive retardation.(1,8) Thus, primary screening of neonates and children as well as awareness of the disorder for the parents are essential (3, 6). Results and Discussion: PAH chromosomal map position and nearby genes: The location of the PAH gene is at chromosome 12. Its long arm (q) is comprised of 13 exons with an approximate length of 90 kb. Figure 1 Chromosome 12 (9) Figure 1, above, is a representation of the entire chromosome 12 with both its short arm (p) and long arm (q) as it appears in the Ensembl website, albeit cropped to fit the page. This figure can be found by searching for the PAH gene and clicking on the ââ¬Å"Locationâ⬠link on the PAH listing. The website lists the location of the gene to be at ââ¬Å"Chromosome 12: 103,232,104-103,311,381 reverse strand.â⬠(2) Though the website does not explicitly state where in chromosome 12 PAH is located, one can infer additional details from the provided images. For example, confusion can ensue from the fact that the indicated location in the image in the Ensembl website is on the long arm on q23.2, while previous sources have stated that it is located on q22-24.2. However, from the code in the location and the additional images, one can infer that these are the transcribed portions of the gene, two of which are illustrated in the site. Furthermore, one can see that the PAH gene is flanked by the genes insulin-like growth factor 1 (IGF1), or somatomedin C, and achaete-scute complex homolog 1 (ASCL1). To obtain the information, though, one needs to explore the interactive image (see Figure 2 below) and go to the individual pages of the neighbor genes. Figure 2 Detailed view of region near PAH (9) The NCBI website, however, while very extensive in details, and containing multiple transcripts pertaining to the PAH gene, can be somewhat confusing with regard to the Map Viewer. Going through the home page and directly searching for the desired gene results in a very large and confusing map, with the details of the gene and its neighboring gene beyond the page to right. For a beginner who is not quite sure what to look for, the NCBI Map Viewer can be very overwhelming. Focusing on the table and not the map, however, one can see that the PAH gene is located in Chromosome 12, in the long arm q22-q24.2; this information is under the heading ââ¬Å"Cytoâ⬠(for cytogenic) and stated as ââ¬Å"12q22-q24.2â⬠(10). Again, this might not be immediately clear to a beginner. Furthermore, the different master map options (Morbid, Gene_cyto, etc.) individually show different arrangements of the symbols, not all of which seem to be genes. Thus, it is very hard to decipher which genes are actually near PAH, although zooming in on the ââ¬Å"Genes on Sequenceâ⬠and ââ¬Å"Phenotypeâ⬠maps do reveal the proximity of IGF1 and ASCL1. In all, for a beginner, the Ensembl website proved to be much easier to use to answer the first question. The intron/exon structure of the PAH gene: It was very difficult to find an illustration of the structure of the PAH gene in the NCBI website. However, the information page for the gene stated that the gene spans 90 kb with the entire sequence and its adjacent regions a total of 171 kb. Furthermore, it states that the gene contains 13 exons, which consequently means that it has 12 introns (number of introns is one less than the number of exons) (1). After some searching, however, beginning with clicking the available links for PAH in the Map Viewer table, the link ââ¬Å"svâ⬠led to a page with the title ââ¬Å"Homo sapiens chromosome 12 genomic contig, GRCh37 reference primary assembly.â⬠Searching for the gene gives the following (zoomed-in and cropped) structure: à Figure 3 Structure of PAH gene (11) Though not obvious from the first glance, later we will see that the bottom sequence actually represents the structure of the PAH, with the vertical green lines representing the 13 exons. After further searching, the following (rotated) PAH structure showing the 13 exons and 12 introns can be found in the Map Viewer under ââ¬Å"ensRNAâ⬠: à Figure 4 Another illustration of the structure of PAH gene (11) Finding those, however, takes previous explicit knowledge and some work to track down the specific illustrations. In contrast, finding the number of exons and introns and an illustration of the structure of the PAH gene in the Ensembl website was very straightforward. The following illustration can be found in the same page as Figure 1: Figure 5 Ensembl illustration of PAH gene structure This strand, one of the transcripts available in the Ensembl page, clearly shows the 13 exons in a DNA sequence. Comparing this structure to Figures 3 and 4, the numbers and the arrangements of the exons and introns are exactly the same. However, relative to all the tedious searching needed to find the same answers in the NCBI website, the information needed for the question was instantly available from the Ensembl site, and the interface was very easy to understand. Common PAH mutations: Mutations in general can refer to abnormalities in function or structure of the concerned enzyme in the gene phenotype. As previously discussed, however, such as the causes of PKU and HPA, the human PAH gene has displayed allelic differences and pathogenic transformations throughout its structure. The common types of mutations and their occurrence according to a previous study are: missense mutations with 62% of the alleles, small or large deletions with 13%, splicing defects with 11%, silent polymorphisms with 6%, nonsense mutations with 5%, and insertions with 2% of the PAH alleles. (6) Table1 PAH mutation statistics Mutation Type: # of Mutation(s) Missense 336 Deletion 73 Splice 62 Silent 32 Nonsense 28 Insertion 10 Sil./Splice 3 Unknown 3 Total mutations: 547 Most reported Mutation (Association): p.R408W (214) Missense, as can be seen above, is the most common cause of mutation in the PAH gene, the molecular mechanism of this is the improper folding of the protein structure, causing aggregation or degradation. As mentioned earlier, the mutations of PAH are commonly caused by single changes in the amino acid. One of the missense mutations, for example, occurs in E1 nucleotide 1 with the change of ATG to GTG. However, there is also missense mutation in region E3 with sequence 187.000 in nucleotide 187; this is called ACC/CCC;CAC/AAC. The second most common type of mutation is deletion. An example of deletion mutation is in regions E2-12 with sequence 168.001 in nucleotide 168. This is called GAG/GAA;G/A and has been noted to have occurred in Palestinians Arabs. (2, 3, 12) à Other examples can be seen in Appendix (I). As mentioned earlier, there are three common variations of PKU: classical PKU, MHP, and non-PKU HPA. These variations which are basically different degrees of severity of the disorder are caused by the different kinds of mutations that cause varying PAH activity as well as allelic variations. The latter effect at the locus of the gene determines the metabolic phenotype of the enzyme deficiency. In general, however, the mutations in the PAH gene are localized in a main part of the gene instead of being randomly distributed, as they occur either within or without the active site. What is interesting to note is that the PAH gene in intron 12 involves the single base change of guanine to adenine in the canonical 5-prime splice donor site where the first identified PKU mutation occurred. (3) Two out of the 6 links given by the Gene Gateway page were no longer working, one was solely dedicated to SNP, one was a link to a database that had links to other databases, and the last two were already explored thoroughly in previous parts of this assignment. The data presented in this section were mostly from the entire site dedicated to PAH gene mutations, the Phenylalanine Hydoxylase Locus Knowledgebase (5). This site, also a database, was arrived at after searching through the Locus Specific Mutation Databases which in turn arrived at from Human Genome Variation Society: Variation Databases and Related Sites. While the OMIM site did give some details about previous studies related to PAH gene mutations, they were more of a history of the mutations and examples of the studies. Finding the needed information was difficult because one needed to go through link after link and website after website, sometimes even arriving at the same website numerous times through different pathwa ys and still not obtaining any results. The PAHdb was by far, the only site that showed any data regarding the common mutations. Single nucleotide polymorphisms (SNPs) of the PAH gene: To date, 1220 SNPs for the PAH gene have been discovered, although GeneCards (2) states only 1097 from the NCBI website. In general, the SNPs involve the changing of a single base, as shown in Appendices I and II. Examples are the three found on exon 3, each of which has a single change of base, name cytocine, thiamine, and adeninine(13). Examples of these PAH gene SNPs are the rs63749677, rs63749676, rs63581460 and rs63499960; some of these are tabulated in Appendix (II). These SNPs are not randomly distributed as out of the 13 exons, they are seen in exons 1-7 and 12. Searching the NCBI website, however, resulted in 55 entries of SNPs with the following format: rs79931499 [Homo sapiens] CAATCCTTTGGGTGTATGGGTCGTAG[C/G]GAACTGAGAAGGGCCGAGGTATTGT 12 The above entry, an example of the results from the query in the NCBI SNP website, shows essential information about the SNP as well as options one can view. Compared to the other related links, which did not yield any useful information other than linking back to this site, the NCBI site dedicated purely to SNPs was simple and the information was easy to retrieve. Due to the very large number of SNPs, however, it would be difficult to evaluate all of them. Designing PCR primers: The given instructions and the program given in the website were rather straightforward, so the designing of the primer was the easiest part of the activity. The mRNA sequence was easily downloadable and the program was user-friendly (14). Being able to design primers this way was very fast and easy. The resulting primers are in Appendix (III). References: 1. [26/08/10]; Available from: http://www.ncbi.nlm.nih.gov/omim/612349 2. Hoeks M, den Heijer M, Janssen M. Adult issues in phenylketonuria. The Netherlands journal of medicine2009;67(1):2. 3. [21/09/09]; Available from: http://www.ensembl.org/index.html. 4. [26/08/10]; Available from: http://www.genecards.org/cgi-bin/carddisp.pl?gene=PAHsearch=pah#loc 5. [26/08/10]; Available from: http://www.pahdb.mcgill.ca. 6. Carter K, Byck S, Waters P, Richards B, Nowacki P, Laframboise R, et al. Mutation at the phenylalanine hydroxylase gene (PAH) and its use to document population genetic variation: the Quebec experience. European Journal of Human Genetics1998;6(1):61-70. 7.à [26/08/10]; Available from: http://www.ncbi.nlm.nih.gov/bookshelf/br.fcgi?book=gndpart=phenylketonuria 8. [26/08/10]; Available from: http://www.ncbi.nlm.nih.gov/bookshelf/br.fcgi?book=genepart=pku 9. [26/08/10]; Available from: http://www.ensembl.org/Homo_sapiens/Location/View?db=core;g=ENSG00000171759;r=12:103232104-103311381;t=ENST00000307000 10. [26/08/10]; Available from: http://www.ncbi.nlm.nih.gov/projects/mapview/maps.cgi?taxid=9606chr=12MAPS=pheno,morbid,genec,decode,ensrna,ensgenes,rnaRn,rnaMm,rnaHs,rnaGga,rnaBt,gbdna,rna,ugHs,genes-rcmd=focusfill=80query=uid(136508683,136446655,12845117,12579049,8990832,717234,698472,11088097,11049717,6481463,570698,568170,34586070,16320694,13572526,34590012,128619463,415205)QSTR=pah 11. [26/08/10]; Available from: http://www.ncbi.nlm.nih.gov/projects/sviewer/?id=NT_029419.12v=65375409..65454686 12. *Robin A Williams, 2 Cyril DS Mamotte,2 *John R Burnett1,3. Phenylketonuria: An Inborn Error of Phenylalanine Metabolism 13.à à à à à à à [updated 21/09/09]; Available from: http://www.ncbi.nlm.nih.gov/SNP/snp_ref.cgi?locusId=5053 14.à à à à à à à [21/09/09]; Available from: http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi Appendices: Appendix (I) Examples 1. Systematic Name: c.1AG Region: E1 Reference (1st): Mutation Name: p.M1V Sequence: 0.000 JOHN SW, ROZEN R, LAFRAMBOISE R, LABERGE C, SCRIVER CR: Novel PKU mutation on haplotype 2 in French-Canadians. Am J Hum Genet 45:905-909, 1989 Other Name: ATG/GTG Length: 1 Nucleotide No.: 1 Rest. Site: -Xba I Mutation Type: Missense Syst. Name gDNA: Date Entered: 1997-01-31 CpG/Fs/Pm: No/No/No 2. Systematic Name: c.3GA Region: E1 EIKEN HG, KNAPPSKOG PM, APOLD J, SKJELKVÃâ¦LE L, BOMAN H: A de novo phenylketonuria mutation: ATG (Met) to ATA (Ile) in the start codon of the phenylalanine hydroxylase gene. Hum Mut 1:388-391, 1992 Mutation Name: p.M1I Sequence: 3.000 Other Name: ATG/ATA Length: 1 Nucleotide No.: 3 Rest. Site: -NspI Mutation Type: Missense Syst. Name gDNA: Date Entered: 1997-01-31 CpG/Fs/Pm: No/No/No 3. Systematic Name: c.117CG Region: E2 FORREST SM, DAHL HH, HOWELLS DW, DIANZANI I, COTTON RGH: Mutation detection in phenylketonuria by using chemical cleavage of mismatch: Importance of using probes from both normal and patient samples. Am J Hum Genet 49:175-183, 1991 Mutation Name: p.F39L Sequence: 117.000 Other Name: TTC/TTG Length: 1 Nucleotide No.: 117 Rest. Site: -MboII, +MaeIII Mutation Type: Missense Syst. Name gDNA: Erlandsen H, Pey AL, Gà ¡mez A, Pà ©rez B, Desviat LR, Aguado C, Koch R, Surendran S, Tyring S, Matalon R, Scriver CR, Ugarte M, Martà nez A, Stevens RC.: Correction of kinetic and stability defects by tetrahydrobiopterin in phenylketonuria patients with certain phenylalanine hydroxylase mutations. Date Entered: 1997-01-31 CpG/Fs/Pm: No/No/No Appendix (II) SNPs of the PAH gene Region Contig position mRNA pos dbSNP rs# cluster id Hetero- zygosity Function dbSNP allele Protein residue Codon pos Amino acid pos exon_12 26716405 1750 rs59326968 N.D. synonymous C Asn [N] 3 426 contig reference T Asn [N] 3 426 exon_7 26728783 1314 rs5030851 N.D. missense T Leu [L] 2 281 contig reference C Pro [P] 2 281 exon_6 26731200 1061 rs5030653 N.D. missense (22bp) [CIKPMLAN] 1 197 frame shift -/TGTATAAAACCCATGCTTGCTA 1 197 contig reference (22bp) [LYKTHACY] 1 197 26731262 1020 rs17852373 N.D. missense G Gly [G] 2 183 contig reference A Glu [E] 2 183 exon_3 26770856 671 rs5030842 N.D. missense C Pro [P] 1 67 contig reference T Ser [S] 1 67 contig reference A Ser [S] 3 36 exon_1 26793098 474 start codon 1 Appendix (III) Designed Primers Exon1 ENSE00001141448 CAGCTGGGGGTAAGGGGGGCGGATTATTCATATAATTGTTATACCAGACGGTCGCAGGCT TAGTCCAATTGCAGAGAACTCGCTTCCCAGGCTTCTGAGAGTCCCGGAAGTGCCTAAACC TGTCTAATCGACGGGGCTTGGGTGGCCCGTCGCTCCCTGGCTTCTTCCCTTTACCCAGGG CGGGCAGCGAAGTGGTGCCTCCTGCGTCCCCCACACCCTCCCTCAGCCCCTCCCCTCCGG CCCGTCCTGGGCAGGTGACCTGGAGCATCCGGCAGGCTGCCCTGGCCTCCTGCGTCAGGA CAACGCCCACGAGGGGCGTTACTGTGCGGAGATGCACCACGCAAGAGACACCCTTTGTAA CTCTCTTCTCCTCCCTAGTGCGAGGTTAAAACCTTCAGCCCCACGTGCTGTTTGCAAACC TGCCTGTACCTGAGGCCCTAAAAAGCCAGAGACCTCACTCCCGGGGAGCCAGCATGTCCA CTGCGGTCCTGGAAAACCCAGGCTTGGGCAGGAAACTCTCTGACTTTGGACAG PCR primer design: No mispriming library specified Using 1-based sequence positions OLIGOà à à à à à à à à à à à à à à à à à à à à à start à à len à à à tm à à à à à à gc% à à anyà à à 3à à à à à à seq LEFT PRIMERà à à à à à à à à 369à à 20à à 59.83à à 55.00à 6.00à 2.00 à à TCCTCCCTAGTGCGAGGTTA RIGHT PRIMERà à à à à à 522à à 20à à 59.98à à 55.00à 3.00à 2.00 à à CAGAGAGTTTCCTGCCCAAG SEQUENCE SIZE: 533 INCLUDED REGION SIZE: 533 PRODUCT SIZE: 154, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 3.00 1 CAGCTGGGGGTAAGGGGGGCGGATTATTCATATAATTGTTATACCAGACGGTCGCAGGCT 61 TAGTCCAATTGCAGAGAACTCGCTTCCCAGGCTTCTGAGAGTCCCGGAAGTGCCTAAACC 121 TGTCTAATCGACGGGGCTTGGGTGGCCCGTCGCTCCCTGGCTTCTTCCCTTTACCCAGGG 181 CGGGCAGCGAAGTGGTGCCTCCTGCGTCCCCCACACCCTCCCTCAGCCCCTCCCCTCCGG 241 CCCGTCCTGGGCAGGTGACCTGGAGCATCCGGCAGGCTGCCCTGGCCTCCTGCGTCAGGA 301 CAACGCCCACGAGGGGCGTTACTGTGCGGAGATGCACCACGCAAGAGACACCCTTTGTAA 361 CTCTCTTCTCCTCCCTAGTGCGAGGTTAAAACCTTCAGCCCCACGTGCTGTTTGCAAACC 421 TGCCTGTACCTGAGGCCCTAAAAAGCCAGAGACCTCACTCCCGGGGAGCCAGCATGTCCA 481 CTGCGGTCCTGGAAAACCCAGGCTTGGGCAGGAAACTCTCTGACTTTGGACAG KEYS (in order of precedence): left primer right primer ADDITIONAL OLIGOS start à à len à à à tm à à à à à à gc% à à anyà à à à à 3à à à à à à à à à à à seq 1 LEFT PRIMERà à à à à à à à 339à à 20à à 59.77à à 50.00 à à 3.00 à à 1.00à à à à ACGCAAGAGACACCCTTTGT RIGHT PRIMERà à à à à à 522à à 20à à 59.98à à 55.00 à à 3.00 à à 2.00 à à à à à CAGAGAGTTTCCTGCCCAAG PRODUCT SIZE: 184, PAIR ANY COMPL: 6.00, PAIR 3 COMPL: 2.00 2 LEFT PRIMERà à à à à à à 318à à 20à à 59.32à à 55.00à 4.00à 2.00 GTTACTGTGCGGAGATGCAC RIGHT PRIMERà à à à à à 522à à 20à à 59.98à à 55.00à 3.00à 2.00 CAGAGAGTTTCCTGCCCAAG PRODUCT SIZE: 205, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 2.00 3 LEFT PRIMERà à à à à à à 157à à 20à à 60.07à à 55.00à 2.00à 0.00 CTGGCTTCTTCCCTTTACCC RIGHT PRIMERà à à à à à 337à à 20à à 59.32à à 55.00à 4.00à 3.00 GTGCATCTCCGCACAGTAAC PRODUCT SIZE: 181, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 1.00 4 LEFT PRIMERà à à à à à à 156à à 20à à 60.07à à 55.00à 3.00à 0.00 CCTGGCTTCTTCCCTTTACC RIGHT PRIMERà à à à à à 337à à 20à à 59.32à à 55.00à 4.00à 3.00 GTGCATCTCCGCACAGTAAC PRODUCT SIZE: 182, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 2.00 Statistics conà à tooà à à inà à à inà à à à à à à à à noà à à tmà à à tmà highà highà à à à à à à high sidà manyà à tarà exclà à badà à à GCà à tooà à tooà à anyà à à 3à polyà à end eredà à à Nsà à getà à regà à GC% clampà à lowà high compl complà à à à Xà stabà à à ok Leftà à à 3637à à à à 0à à à à 0à à à à 0à à 162à à à à 0à à 419à 2558à à à à 0à à à à 2à à à 22à à à 73à à 401 Rightà à 3701à à à à 0à à à à 0à à à à 0à à 130à à à à 0à à 321à 2817à à à à 0à à à à 2à à à à 0à à à 78à à 353 Pair Stats: considered 140, unacceptable product size 129, high end compl 3, ok 8 primer3 release 1.1.4 KEYS (in order of precedence): left primer right primer ADDITIONAL OLIGOS start à à len à à à tm à à à à à à gc% à à anyà à à 3à à à à à à à à seq 1 LEFT PRIMERà à à à à à à à 19à à 20à à 60.21à à 50.00à 5.00à 2.00 à à à à GCAGTGCCCTCCAGAAAATA RIGHT PRIMERà à à à à à 265à à 20à à 58.12à à 40.00à 3.00à 0.00 à à TCAAAGATGACCCCAAAAGA PRODUCT SIZE: 247, PAIR ANY COMPL: 2.00, PAIR 3 COMPL: 0.00 2 LEFT PRIMERà à à à à à à à 19à à 20à à 60.21à à 50.00à 5.00à 2.00à à à GCAGTGCCCTCCAGAAAATA RIGHT PRIMERà à à à à à 260à à 22à à 60.05à à 40.91à 4.00à 0.00 à à GATGACCCCAAAAGATTTACCA PRODUCT SIZE: 242, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 1.00 3 LEFT PRIMERà à à à à à à à 45à à 20à à 60.39à à 50.00à 6.00à 1.00à à à AGCCATGGACAGAATGTGGT RIGHT PRIMERà à à à à à 265à à 20à à 58.12à à 40.00à 3.00à 0.00 à à TCAAAGATGACCCCAAAAGA PRODUCT SIZE: 221, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 1.00 4 LEFT PRIMERà à à à à à à à 19à à 20à à 60.21à à 50.00à 5.00à 2.00 à à à à GCAGTGCCCTCCAGAAAATA RIGHT PRIMERà à à à à à 258à à 20à à 57.92à à 40.00à 4.00à 0.00 à à TGACCCCAAAAGATTTACCA PRODUCT SIZE: 240, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 1.00 Statistics conà à tooà à à inà à à inà à à à à à à à à noà à à tmà à à tmà highà highà à à à à à à high sidà manyà à tarà exclà à badà à à GCà à tooà à tooà à anyà à à 3à polyà à end eredà à à Nsà à getà à regà à GC% clampà à lowà high compl complà à à à Xà stabà à à ok Leftà à à 7708à à à à 0à à à à 0à à à à 0à à 791à à à à 0à 4562à à 600à à à à 0à à à 14à à à à 0à à à 52à 1689 Rightà à 7734à à à à 0à à à à 0à à à à 0à 1269à à à à 0à 4609à à 311à à à à 0à à à à 6à à à à 0à à à 44à 1495 Pair Stats: considered 2222, unacceptable product size 2195, high end compl 6, ok 21 primer3 release 1.1.4
Tuesday, November 26, 2019
John H. Ostrom - A Profile of the Famous Paleontologist
John H. Ostrom - A Profile of the Famous Paleontologist Name: John H. Ostrom Born/Died: 1928-2005 Nationality: American Dinosaurs Discovered or Named: Deinonychus, Sauropelta, Tenontosaurus, Microvenator About John H. Ostrom Nowadays, pretty much all paleontologists agree that birds descended from dinosaurs. However, that wasnââ¬â¢t the case in the 1960s, when John H. Ostrom of Yale University was the first researcher to propose that dinosaurs had more in common with ostriches and swallows than with snakes, turtles and alligators (to be fair, the heavyweight Americanà paleontologist Othniel C. Marsh, who also taught at Yale, had proposed this idea in the late 19th century, but he didnt have enough evidence at his disposal to carry the weight of scientific opinion). Ostroms theory about the dinosaur-bird evolutionary link was inspired by his 1964 discovery of Deinonychus, a large, bipedal raptor that displayed some uncannily birdlike characteristics. Today, its (pretty much) an established fact that Deinonychus and its fellow raptors were covered with feathers, not a popular image a generation ago, and one that even current dinosaur enthusiasts have difficulty accepting. (In case you were wondering, those Velociraptors in Jurassic Park were really modeled after theà much biggerà Deinonychus, disregarding the fact that they were portrayed with green reptilian skin rather than feathers.) Fortunately for him, Ostrom lived long enough to learn about the trove of indisputably feathered dinosaurs recently discovered in China, which cemented the dinosaur-bird connection. When he discovered Deinonychus, Ostrom opened the dinosaur equivalent of a hornets nest. Paleontologists werent used to dealing with muscular, man-sized, predatory dinosaursas opposed to familiar, multi-ton carnivores like Allosaurus or Tyrannosaurus Rexwhich prompted speculation about whether an ostensibly cold-blooded reptile could engage in such energetic behavior. In fact, Ostroms student Robert Bakker was the first paleontologist to forcefully propose that all theropod dinosaurs were warm-blooded, a theory thats currently on only slightly shakier ground than the dinosaur-bird connection. ââ¬â¹By the way, he wasnt responsible for either discovering or naming this dinosaur, but the type species of Utahraptor (U. ostrommaysorum) was named after John Ostrom and Chris Mays, a pioneer in animatronic dinosaurs.
Friday, November 22, 2019
Gustar Conjugation in Spanish, Translation, and Examples
Gustar Conjugation in Spanish, Translation, and Examples The Spanish verb gustar can be translated as to like. This verb may be confusing for Spanish learners because gustar is considered a defective or impersonal verb, so it is often conjugated in the third person only. In addition, it requires a variation in the sentence structure. This article includes gustar conjugations in the indicative mood (present, past, conditional, and future), the subjunctive mood (present and past), the imperative mood, and other verb forms, as well as examples, translations, and explanations of the peculiarities of the verb gustar. Using the Verb Gustar If youre a beginner at Spanish, chances are most of the sentences youve been using as examples follow roughly the same word order as we use in English, with the verb following the subject. But Spanish also frequently places the subject after the verb, and that is usually true with gustar. Here are some examples of gustar in action: Me gusta el coche. (I like the car.)Nos gustan los coches. (We like the cars.)Le gustan los coches. (You/he/she likes the cars.) As you can see, the sentences arent quite what you might expect. Instead of following the form person who likes verb the object liked, they follow the form indirect-object pronoun representing the person who likes verb the object liked (the indirect-object pronouns are me, te, le, nos, os, and les). In these sentences, the object liked is the subject in Spanish. Also, note that the subject of these sentences (the object that is liked) is always accompanied by the definite article (el, la, los, las). If this seems confusing, heres an approach that might help: Instead of thinking of gustar as meaning to like, it is both more accurate and makes more sense in this sentence structure to think of it as meaning to be pleasing. When we say, I like the car, the meaning is much the same as saying, the car is pleasing to me. In plural form, it becomes the cars are pleasing to me, with a plural verb. Note, then, the differences in the common and literal translations below: Me gusta el coche.à (I like the car. Literally, the car is pleasing to me.)Nos gustan los coches. (We like the cars. Literally, the cars are pleasing to us.)Le gustan las camionetas. (You /he/she likes the pickups. Literally, the pickups are pleasing to you/him/her.) When the pronoun le or les is used, as in the third example, the context might not always make clear who is the person doing the liking. In that case, you can add the prepositional phrase a the person liking, as shown below, at the beginning of the sentence (or less commonly at the end of the sentence). Note that the indirect-object pronoun cannot be omitted; the prepositional phrase clarifies the indirect-object pronoun rather than replacing it. A Carlos le gusta el coche. (Carlos likes the car.)A Marà a le gustan las camionetas. (Marà a likes the pickups.)à ¿A ustedes les gusta el coche? (Do you like the car?) Conjugating Gustar Because gustar is nearly always used with subjects in the third person, it is often considered a defective verb. However, it can also be used with other subjects to talk about liking different people. Be careful though, because often the verb gustar, when used with people, denotes a romantic attraction. To talk about simply liking people, a more common expression uses the verb caer bien, as in Marà a me cae bien (I like Marà a). In the table below, you can see how gustar can be conjugated for each different subject using this romantic meaning. Yo gusto Yo le gusto a mi novio. My boyfriend likes me. / I am pleasing to my boyfriend. Tà º gustas Tà º le gustas a tu esposa. Your wife likes you. / You are pleasing to your wife. Usted/à ©l/ella gusta Ella le gusta a Carlos. Carlos likes her. / She is pleasing to Carlos. Nosotros gustamos Nosotros le gustamos a muchas personas. Many people like us. / We are pleasing to many people. Vosotros gustis Vosotros le gustis a Pedro. Pedro likes you. / You are pleasing to Pedro. Ustedes/ellos/ellas gustan Ellos le gustan a Marta. Marta likes them. / They are pleasing to Marta. Since gustar is frequently used to talk about things being pleasing to people, or people liking things, the tables below show the conjugations of the verb with the liked objects as the subject of the sentence. The verb takes the form of the third person singular if the person likes a singular noun or verb, and the third person plural if the person likes a plural noun. Gustar Present Indicative A mà me gusta(n) Me gusta la comida china. I like Chinese food. A ti tegusta(n) Te gustan las frutas y verduras. You like fruits and vegetables. A usted/à ©l/ella legusta(n) Le gusta bailar salsa. She likes to dance salsa. A nosotros nosgusta(n) Nos gusta el arte moderno. We like modern art. A vosotros osgusta(n) Os gusta caminar por la ciudad. You like walking around the city. A ustedes/ellos/ellas lesgusta(n) Les gustan los colores vivos. They like bright colors. Preterite Indicative The preterite tense is used to talk about completed actions in the past. In the case of gustar, it would be used in the context of seeing or trying something for the first time and liking it, or having liked something only for a certain amount of time. A mà me gustà ³/gustaron Me gustà ³ la comida china. I liked Chinese food. A ti tegustà ³/gustaron Te gustaron las frutas y verduras. You liked fruits and vegetables. A usted/à ©l/ella legustà ³/gustaron Le gustà ³ bailar salsa. She liked to dance salsa. A nosotros nosgustà ³/gustaron Nos gustà ³ el arte moderno. We liked modern art. A vosotros osgustà ³/gustaron Os gustà ³ caminar por la ciudad. You liked walking around the city. A ustedes/ellos/ellas lesgustà ³/gustaron Les gustaron los colores vivos. They liked bright colors. Imperfect Indicative The imperfect tense is used to talk about ongoing or repeated actions in the past. In the case of gustar, it would refer to someone who used to like something, but doesnt anymore. A mà me gustaba(n) Me gustabala comida china. I used to like Chinese food. A ti tegustaba(n) Te gustabanlas frutas y verduras. You used to like fruits and vegetables. A usted/à ©l/ella legustaba(n) Le gustababailar salsa. She used to like to dance salsa. A nosotros nosgustaba(n) Nos gustabael arte moderno. We used to like modern art. A vosotros osgustaba(n) Os gustabacaminar por la ciudad. You used to likewalking around the city. A ustedes/ellos/ellas lesgustaba(n) Les gustaban los colores vivos. Theyused to like bright colors. Future Indicative A mà me gustar(n) Me gustarla comida china. I will like Chinese food. A ti tegustar(n) Te gustarnlas frutas y verduras. You will like fruits and vegetables. A usted/à ©l/ella legustar(n) Le gustarbailar salsa. She will like to dance salsa. A nosotros nosgustar(n) Nos gustarel arte moderno. We will like modern art. A vosotros osgustar(n) Os gustarcaminar por la ciudad. You will likewalking around the city. A ustedes/ellos/ellas lesgustar(n) Les gustarn los colores vivos. Theywill like bright colors. Periphrasticà Future Indicativeà A mà me va(n) a gustar Me va a gustar la comida china. I am going to like Chinese food. A ti teva(n) a gustar Te van a gustarlas frutas y verduras. You aregoing to like fruits and vegetables. A usted/à ©l/ella leva(n) a gustar Le va a gustarbailar salsa. She isgoing to like to dance salsa. A nosotros nosva(n) a gustar Nos va a gustarel arte moderno. We aregoing to like modern art. A vosotros osva(n) a gustar Os va a gustarcaminar por la ciudad. You aregoing to likewalking around the city. A ustedes/ellos/ellas lesva(n) a gustar Les van a gustar los colores vivos. Theyaregoing to like bright colors. Present Progressive/Gerund Form The gerund or present participle can be used as an adverb, or to form progressive tenses like the present progressive. Present Progressive ofGustar est(n) gustando A ella le est gustando bailar salsa. She is liking dancing salsa. Past Participle The past participle can be used as an adjective or to form compound verb forms using the auxiliary verb haber, such as the present perfect. Present Perfect of Gustar ha(n) gustado A ella le ha gustado bailar salsa. She has liked dancing salsa. Conditional Indicative The conditional tense is used to talk about possibilities. A mà me gustarà a(n) Me gustarà ala comida china, pero es muy salada. I would like Chinese food, but it is very salty. A ti tegustarà a(n) Te gustarà anlas frutas y verduras si fueras ms saludable. You would like fruits and vegetables if you were healthier. A usted/à ©l/ella legustarà a(n) Le gustarà abailar salsa si hubiera tomado clases. She would like to dance salsa if she had taken lessons. A nosotros nosgustarà a(n) Nos gustarà ael arte moderno, pero preferimos el arte clsico. We would like modern art, but we prefer classical art. A vosotros osgustarà a(n) Os gustarà acaminar por la ciudad si no fuera peligroso. You would likewalking around the city if it were not dangerous. A ustedes/ellos/ellas lesgustarà a(n) Les gustarà an los colores vivos, pero prefieren los colores claros. Theywould like bright colors, but they prefer light colors. Present Subjunctive Que a mà me guste(n) El cocinero espera que me guste la comida china. The cook hopes I like Chinese food. Que a ti te guste(n) Tu madre espera que te gusten las frutas y verduras. Your mother hopes that you like fruits and vegetables. Que a usted/à ©l/ella le guste(n) Su novio espera que a ella le guste bailar salsa. Her boyfriend hopes that she like to dance salsa. Que a nosotros nos guste(n) El artista espera que nos guste el arte moderno. The artist hopes that we like modern art. Que a vosotros os guste(n) La doctora espera que nos guste caminar por la ciudad. The doctor hopes that we like walking around the city. Que a ustedes/ellos/ellas les guste(n) El diseà ±ador espera que a ellas les gusten los colores vivos. The designer hopes that they like bright colors. Imperfect Subjunctive The imperfect subjunctive can be conjugated in two different ways: Option 1 Que a mà me gustara(n) El cocinero esperaba que me gustara la comida china. The cook hoped I like Chinese food. Que a ti te gustara(n) Tu madre esperaba que te gustaran las frutas y verduras. Your mother hoped that you like fruits and vegetables. Que a usted/à ©l/ella le gustara(n) Su novio esperaba que a ella le gustara bailar salsa. Her boyfriend hoped that she like to dance salsa. Que a nosotros nos gustara(n) El artista esperaba que nos gustara el arte moderno. The artist hoped that we like modern art. Que a vosotros os gustara(n) La doctora esperaba que nos gustara caminar por la ciudad. The doctor hoped that we like walking around the city. Que a ustedes/ellos/ellas les gustara(n) El diseà ±ador esperaba que les gustaran los colores vivos. The designer hoped that they like bright colors. Option 2 Que a mà me gustase(n) El cocinero esperaba que me gustase la comida china. The cook hoped I like Chinese food. Que a ti te gustase(n) Tu madre esperaba que te gustasen las frutas y verduras. Your mother hoped that you like fruits and vegetables. Que a usted/à ©l/ella le gustase(n) Su novio esperaba que a ella le gustase bailar salsa. Her boyfriend hoped that she like to dance salsa. Que a nosotros nos gustase(n) El artista esperaba que nos gustase el arte moderno. The artist hoped that we like modern art. Que a vosotros os gustase(n) La doctora esperaba que nos gustase caminar por la ciudad. The doctor hoped that we like walking around the city. Que a ustedes/ellos/ellas les gustase(n) El diseà ±ador esperaba que les gustasen los colores vivos. The designer hoped that they like bright colors. Gustar Imperative The imperative mood is used to give commands or orders. However, remember that gustar is a different verb, where the subject of the sentence is the object that pleases the person. Since you cant command a thing to please someone, the imperative forms of gustar are very rarely used. If you wanted to tell someone to like something, you would say it in a more indirect way using a structure with the subjunctive, such as Quiero que te gusten las frutas (I want you to like fruit) or Exijo que te guste bailar (I demand that you like to dance).
Thursday, November 21, 2019
Managing Communication Coursework Example | Topics and Well Written Essays - 750 words
Managing Communication - Coursework Example SOK ââ¬â Fitness is not an exception when it comes to appropriate management of information as it is the verge of remaining competitive and relevant in the market2. Members of the marketing team in SOK ââ¬â Fitness come across a wide range of date in their daily operations most of which are significant for effective decision making in areas of improving the image and publicity of the Fitness Center. The information that gets at the disposal of the marketing team is highly concerned with the financial and sales aspects of the Fitness Center. Information and knowledge is collected from the both internal and external sources. Internal data is collected through everyday interaction with the customers. For instance, the marketing team derives a wide range of information from the visit reports by the sales personnel, received and delivered orders, return inwards, customer enquiries, sales invoices, and recorded costs3. Marketersââ¬â¢ interaction with the clients provides a vital source of secondary information which can be used for marketing research. A wide range of information is also collected from the external sources which include but not limited to Government statistics, Trade associations, Commercial services, National and international institutions. Most of the information gathered from external sources does not directly reflect the affairs and business processes of the organizations4. However, they portray an aggregate data about the affairs of the entire industry. Such information is considered relevant because it is gathered from various operators in the fitness center and as such they are highly valuable market research purposes5. Before information is formatted in SOK ââ¬â Fitness it is first categorized into whether it should be structured or unstructured. Structured information refers to information which should formatted using specified rules and guidelines for precision and formality while unstructured information does not require rule s and guidelines when being formatted. Unstructured data will be used for unstructured decisions while the structured information shall be used for structured decisions6. Another important point to consider when formatting information in the Fitness Center is the scope and frequency of use. Computer system will be used for formatting the information gathered from various sources that is both internal and external sources. Management information systems, Expert Systems and Decision Support Systems will be used for formatting and procession of the data gathered from internal and external sources for a highly intelligible information that would ease decision making process. Already formatted information will be stored in secondary storage devices such as computer hard disks and the compact disks for future utilization7. Marketing team in the SOK ââ¬â Fitness are relying on the easiest way of storing information gathered from various sources as well as the already formatted informat ion in computer hard disk and compact disks as this does not involve exorbitant spending on storage of information. The choice of a storage facility will have an impact on the effectiveness on the data in future. A wrong choice will translate to significant damages on data stored8. The stored information
Tuesday, November 19, 2019
Changing Employee Benefits at Longos Assignment Example | Topics and Well Written Essays - 250 words
Changing Employee Benefits at Longos - Assignment Example its in that by getting onboard the personnel to aid in designing the benefits scheme, they will feel rejuvenated and appreciated hence will fulfill their roles with new found passion and drive thus enabling the company realize new client markets and enhanced revenue precincts as a consequence of the extra input involved. When compared and to the recommendations in chapter eight, Longos approach to employee benefits was a very bold move given the challenges they experienced such as speaking of diverse languages and bringing together a workforce of approximately 2000 people to read from the same script. (McGraw-Hill Ryerson Videos, 2011) But through proper planning and involving the teams they were in a position to pull it off, and the personnel were content with the upshot of the rebranding of their benefits. Longos should always try and conduct trainings and create awareness for the employees so that they understand their benefits. It could be improved by conducting workshops and taking part in team building
Saturday, November 16, 2019
Death Penalty Essay Example for Free
Death Penalty Essay Should be Abolished from our Judicial System Fagan, Jeffrey A. Capital Punishment: Deterrent Effects Capital Costs. www. law. columbia. edu/law-school/communications/reports. Summer 2006. Web. 06 April 2011. The article shows that the states are broken, and the money that we are spending on trials to punish criminals to death penalty should be used in prevention. If you compare the costs of the process and the effects, USA should abolish the death penalty from our Judicial System. It is an excellent article, with detailed information and written y someone who has done many research about capital punishment. It will be very helpful to back up my thesis. Stamper, Norm. A Former Cop Speaks out Against the Death Penalty. www. deathpenalty. org/article. php. 17 Nov 2007. Web 04/02/2011. The article describes an experience of a former cop, who worked for 29 years at San Diego Police Department. In his opinion death penalty is a waste of money, and fails terribly to reduce crime. He feels like we are better off spending the money and resources on programs such as mental health care, drugs and alcohol treatment, after school programs and education. The article is very interesting and comes from a reliable source. He makes very good points on why we should abolish the death penalty. Death Penalty Information Center: Facts about the Death Penalty. www. deathpenaltyinfo. org. 1 April 2011. Web 04/04/2011 This is a complete and updated article about death penalty. It shows all the details and statistics about the number of defendants who were executed and their race, number of victims in death penalty cases and their races, and number of death row exonerations by state. Definitely, I will use this article on my essay because the information will ake my argument stronger, and it comes from a reliable source. Bedau, Hugo, and Paul Cassel. Debate the Death Penalty: Should America Have Capital Punishment? The experts on Both Sides Make Their Best Case. New York: Oxford University Press 2004. In this book, the author and other experts debate several questions about death penalty. It provides insights on advantages and disadvantages of death penalty, and opinions come from people with different ways of thinking. This book will be helpful because it has credible information, and the author is an expert on the subject of death penalty. Some chapter will serve as a counter argument to my thesis. Amnesty USA. Death Penalty and Innocence. http://www. amnestyusa. org/deathpenalty-facts/death-penalty-and-innocence. Web. 04 April 2011. The article shows how the governor, George Ryan, of Illinois feels about the death penalty. He can not support it because the system is full of errors and he is not sure that everyone sent to death row is guilt. He does not want to see the state taking an innocent life. The article is full of good information, with facts, and many details about the number of innocent people that has been released from death row. The article will be helpful because it is based on statistics, data, and full of facts. Folduary, Fred. Abolish the Death Penalty. Editorial. The Progress Report. 2000 www. progress. org. Web. 04 April 2011. The article shows that there are four justifications for capital punishment: protection of society, reform and rehabilitate the criminal, deterrence, restitution of the damage. Punishing the criminal to death penalty will not solve any of these problems. It is a well written article, based on researches and statistics. To make my essay stronger, with valid points, I will use some quotations from this article.
Thursday, November 14, 2019
Life in a Small Village in Greece :: essays papers
Life in a Small Village in Greece This paper is based upon the biography of a couple that is living in Playiari, which is a village 25 km from Thessaloniki, Greece. The couple is three years married, after being four years engaged, and now they are living at a house of their own. They do not have any children, so far, but they have a dog whose name is Lambros. Their names are Tasos and Efi. He is the owner of a cafà © and she is working at a branch of an insurance company. I met them almost six years ago when I got hired by Tasos as a waiter in his cafà ©, and I chose them for my paper because first of all I feel really comfortable with them and second because they are young so the research that is going to be done to be more vivid and up to date. What is going to be presented in this paper are the various information that I have obtained from them, for several aspects of their lives. Furthermore, what is to be accomplished is the comparison of their lives with those of their grandparents and alongside with this the comparison and contrast of these information with the ones in the articles that were covered in class. Firstly what is to be conferred are information about Tasos family. Tasos family originated from Kallipoli which was a suburb of Constantinople (Instanbul). They were living there before the destruction of Asia Minor and the exchange of population between Greece and Turkey taking place. When the exchange of the populations took place his grandfather moved straight to Playiari, which basically is a village composed of immigrants who came from there and at that point in time was nothing but a complex of 4-5 houses. Their residents were locals, who had conflicts with the incoming people, because they did not want others to claim land in that territory. Finally most of the immigrants got to claim and own a piece of land. Tasos was born 32 years ago in Edessa, a city close to Thessaloniki. When he was two years old his family moved in a village, which was located in the district(nomos) Pelas and it is called St.George. They remained there for about nine years, until Tasos became 1 1 years old, and after that they moved to Lakoma, a village in Halkidiki. Life in a Small Village in Greece :: essays papers Life in a Small Village in Greece This paper is based upon the biography of a couple that is living in Playiari, which is a village 25 km from Thessaloniki, Greece. The couple is three years married, after being four years engaged, and now they are living at a house of their own. They do not have any children, so far, but they have a dog whose name is Lambros. Their names are Tasos and Efi. He is the owner of a cafà © and she is working at a branch of an insurance company. I met them almost six years ago when I got hired by Tasos as a waiter in his cafà ©, and I chose them for my paper because first of all I feel really comfortable with them and second because they are young so the research that is going to be done to be more vivid and up to date. What is going to be presented in this paper are the various information that I have obtained from them, for several aspects of their lives. Furthermore, what is to be accomplished is the comparison of their lives with those of their grandparents and alongside with this the comparison and contrast of these information with the ones in the articles that were covered in class. Firstly what is to be conferred are information about Tasos family. Tasos family originated from Kallipoli which was a suburb of Constantinople (Instanbul). They were living there before the destruction of Asia Minor and the exchange of population between Greece and Turkey taking place. When the exchange of the populations took place his grandfather moved straight to Playiari, which basically is a village composed of immigrants who came from there and at that point in time was nothing but a complex of 4-5 houses. Their residents were locals, who had conflicts with the incoming people, because they did not want others to claim land in that territory. Finally most of the immigrants got to claim and own a piece of land. Tasos was born 32 years ago in Edessa, a city close to Thessaloniki. When he was two years old his family moved in a village, which was located in the district(nomos) Pelas and it is called St.George. They remained there for about nine years, until Tasos became 1 1 years old, and after that they moved to Lakoma, a village in Halkidiki.
Monday, November 11, 2019
Sheltered Instruction and the English Language Learner
Each twelvemonth, the United States has become more ethnically and linguistically diverse, with more than 90 per centum of recent immigrants coming from non-English speech production states. There are presently more than 10.5 million school-aged kids in the United States who live in places in which a linguistic communication other than English is spoken. Some of these pupils are fluid in English, while others are non ( U.S. Census Bureau, 2005 ) . Guaranting that pupils who are non fluid in English receive a quality instruction, and have a quality instruction, and achieve the same academic success as their English proficient equals, is an indispensable portion of the Elementary and Secondary Education Act ( ESEA ) , as reauthorized by the No Child Left Behind Act of 2001 ( NCLB ) , ( U.S. Department of Education, 2007 ) . Harmonizing to the National Clearinghouse for Language Acquisition ( 2007 ) , informations submitted by provinces indicate that there are about 5 million pupils classified as Limited English proficient ( LEP ) through their engagement in a Title III appraisal of English Language proficiency. Harmonizing to the U.S. Census, LEP pupils are among the fastest-growing demographic group of pupils in the United States. While the overall school population has grown by less than 3 per centum in the last 10 old ages, the figure of LEP pupils has increased by more than 60 per centum in that same clip. While the figure of pupils with limited proficiency in English has grown exponentially across the United States, their degree of academic accomplishment has lagged significantly behind that of their linguistic communication bulk equals ( Echevarria, Vogt, & A ; Short, 2004 ) . These findings reflect turning grounds that most schools are non run intoing the challenge of educating linguistically and culturally diverse pupils good. This deficiency of success in educating ELLs is debatable because federal and province authoritiess expect all pupils to run into high criterions and have adjusted national and province appraisals to reflect new degrees of accomplishment and to suit demands under the NCLB Act of 2001. In add-on, the criterions motion, which is brushing the United States, has straight impacted the course of study and methodological analysis of K-8 ESL plans ( Echevarria et al. , 2008 ) . Second linguistic communication scholars, every bit good as mainstream pupils, are now req uired to larn state-prescribed content course of study and show this cognition through public presentation on state-mandated trials. In add-on, TESOL ââ¬ËS ESL Standards for Pre-K-12 pupils has focused attending on the acquisition demands of ELLs by bridging the spread between traditional ESL course of study and the development of academic proficiencies ( TESOL, 2007 ) . Although these authorizations will hold a positive impact on the instruction of ELLs, they present instructional challenges to ELL and mainstream instructors who work with 2nd linguistic communication scholars ( Echevarria et al. , 2008 ) . Once pupils have been identified as LEP utilizing state-approved ELP appraisal, their school territories must find the type of research-based Language Instruction Educational Program ( LIEP ) for K-12 LEP pupils that will function their pupils best. Title III requires territories to supply high quality LIEPs that are based on scientifically based research showing the effectivity of the plan ( National Clearinghouse for Language Acquisition, 2007 ) . One such plan that focuses on developing literacy in English is Sheltered Instruction Observation Protocol ( SIOP ) . Sheltered Instruction ( SI ) is non a plan, it is a procedure of readying, direction and appraisal that is centered on clearly communicated content and linguistic communication larning marks. It is a procedure of learning content to English Language Learners in a mode that will guarantee their academic success while advancing their development of the English linguistic communication. Sheltered Instruction is delivered to ELL pupils through relevant, meaningful, and comprehendible agencies. There is no set method ( s ) on how to shelter direction ; nevertheless, the end of this procedure should be to guarantee that whatever construct or larning nonsubjective is being taught to the pupils is clearly understood by them. Therefore, the direction should be sheltered to the extent that it matches the pupils ââ¬Ë linguistic communication ability to understand the lesson. The term ââ¬Å" sheltered â⬠refers to the agencies for doing academic content comprehensible for English scholars while they develop English proficiency. Classrooms with sheltered direction learning methods may be used in self-contained ELL classes that contain both English talkers and English scholars. The schemes identified in SIOP are important for English scholars and may turn out good to other scholars as good ( Echevarria et al. , 2008 ) . The SI attack must non be viewed as a set of extra or replacement instructional techniques that instructors utilize in their schoolrooms. The sheltered attack draws from and regards methods and schemes advocated for both 2nd linguistic communication and mainstream schoolrooms. The Sheltered Instruction Observation Protocol provides concrete illustrations of the characteristics of sheltered direction that can heighten and spread out instructors ââ¬Ë direction. SIOP organizes 30 characteristics of good lessons for English scholars into eight overarching constituents: Preparation, Building background, Comprehensible Input, Strategies, Interaction, Practice/Application, Lesson Delivery, and Review/Assessment. These constituents emphasize the instructional patterns that are critical for ELLs every bit good as high-quality patterns that benefit all pupils. Lesson planning and readying are critical to both the pupil ââ¬Ës and the instructor ââ¬Ës success. For optimal acquisition to take topographic point, be aftering must bring forth lessons that will enable the pupils to do connexions between their ain cognition and experiences, and the new information being taught ( Bouchard, 2005 ) . With careful planning, acquisition is made more meaningful and relevant by including appropriate motivation stuffs and activities that promote real-life application of constructs studied. In effectual direction for ELLs, concrete content aims that identify what pupils should cognize and be able to make should be the steering force for learning and larning. These aims should back up school-district and state-content criterions and larning results. Foe English scholars, content aims for each lesson need to be stated merely, orally and in authorship, and tied to specific grade degree criterions ( Echevarria & A ; Graves, 2007 ) . An effectual lesson program focuses on merchandises and larning straight related to these aims. While carefully be aftering and presenting content aims, sheltered direction instructors should besides integrate in their lesson programs techniques that support pupils ââ¬Ë linguistic communication development ( Short, 1999 ) . As with content aims, linguistic communication aim should be stated clearly and merely both orally and in composing. A broad assortment of linguistic communication aims can be planned harmonizing to the ends and activities in the lesson. Language objectives may concentrate on vocabulary development, reading comprehension accomplishments pattern, objectives that focal point on functional linguistic communication usage, higher-order thought accomplishments, every bit good as specific grammar accomplishments. Planing should besides affect careful consideration of the content constructs and grade-level content criterions to be taught. In sheltered schoolrooms, this involves guaranting that although the stuff may be adapted to run into the demands of ELLs, the content should non be diminished. When be aftering lessons around content constructs, the followers should be considered: ( 1 ) the pupils ââ¬Ë first linguistic communication literacy ( L1 ) , ( 2 ) their English proficiency degree ( L2 ) , ( 3 ) their reading ability, ( 4 ) the cultural and age rightness of the L2 stuffs, and ( 5 ) the trouble degree of the stuff to be read ( Gunderson, 1991 ) . Lesson readying should besides reflect the sum of background experience needed to larn and use the content constructs, and include ways to trip pupils ââ¬Ë anterior cognition. A reader ââ¬Ës scheme, or cognition of the universe, provides a footing for understanding, acquisition, and retrieving facts and thoughts presented. Students with cognition of a subject have better callback and are better able to lucubrate on facets of the subject than those who have limited cognition of subjects ( Hill, 2007 ) . Harrell & A ; Jordan ( 2004 ) have suggested that when readers lack the anterior cognition necessary to read, three major instructional intercessions need to be considered: ( 1 ) Teach vocabulary as a prereading measure ; ( 2 ) provide experiences ; and ( 3 ) present a conceptual model that will enable pupils to construct appropriate background for themselves. In sheltered direction lessons for ELLs, instructors select words that are critical for understanding the text or stuff and supply a assortment of ways for pupils to larn, retrieve, and utilize the words in meaningful contexts. There are multiple ways that background experiences can be created or ways that instructors can utilize the experiences that pupils bring. Connecting the pupils ââ¬Ë ain background experiences to the text, triping their background cognition and showing background information about the text to be read are all effectual ways of increasing comprehension for ELLs. The 3rd intercession, supplying ways for pupils to construct background cognition, can be accomplished by learning ELLs to utilize in writing organisers and other auxiliary stuffs. Effective SI involves the usage of many auxiliary stuffs that support the nucleus course of study and contextualize acquisition ( Echevarria et al. , 2008 ) . Auxiliary stuffs provide a real-life context and enable ELL pupils to bridge anterior experiences with new larning. These attacks can be used throughout a lesson and supply ways for doing the text accessible for all pupils thereby accommodating them so that the content constructs are left integral ( Short, 1991 ) . Effective sheltered direction takes into history the alone features of English scholars. For ELLs, the instructor makes verbal communicating more comprehendible by consciously go toing to the pupils ââ¬Ë lingual demands. Making accommodations to speech so that the message to the pupils is apprehensible is referred to as comprehendible input ( Krashen, 1985 ) . In the SI schoolroom, instructors invariably modulate and adjust their address when learning ELLs to guarantee that the context is comprehendible. Concepts are taught utilizing a assortment of techniques, including mold, gestures, hands-on activities, and presentations, so that pupils understand and learn the content stuff. Effective SI instructors besides provide accounts of academic undertakings that make clear what pupils are expected to carry through and that promote pupil success ( Echevarria et al. , 2008 ) . English scholars benefit from structured chances to utilize and pattern English in multiple scenes and across content countries. Harmonizing to Echevarria et Al. ( 2008 ) surveies have indicated, that in most schoolrooms, instructors dominate the lingual facets of the lesson, go forthing pupils badly limited in footings of chances to utilize linguistic communication in a assortment of ways. In the SI schoolroom, content categories are structured so that pupils are interacting in a collaborative probe of a organic structure of cognition. This SIOP component emphasizes the importance of equilibrating lingual turn-taking between the instructor and pupils, and among pupils. Students benefit from utilizing and practising English as a agency of showing their thoughts, sentiments, and replies. SI lessons are structured in ways that promote pupil treatment and they strive to supply a more balanced lingual exchange between pupils and their instructors. Teachers in Sheltered Instruction school rooms must make multiple chances for ELL pupils to utilize the English linguistic communication in order to spread out their verbal and written responses. ELL pupils will merely go proficient in English if they pattern the linguistic communication in reliable state of affairss. Frequent pattern reduces pupils ââ¬Ë anxiousness while take parting in category treatments and encourages them to take hazards in utilizing the linguistic communication ( Herrell et al. , 2004 ) . Integrating a figure of grouping constellations into lessons frequently facilitates utilizing English in ways that besides supports the lessons ââ¬Ë aims. Sheltered Direction categories are characterized by a assortment of grouping constructions, including single work, spouses, threes, little groups of four, concerted acquisition groups, and whole groups ( Hill, 2007 ) . Groups may besides change in that they may be homogenous or heterogenous by gender, linguistic communication proficiency, linguistic communication background, and/or ability. Using a assortment of grouping schemes helps to keep pupils ââ¬Ë involvement and increases their engagement in the acquisition procedure. It besides increases the opportunity that a pupil ââ¬Ës preferable manner of direction, or larning manner, will be matched ( Echevarria et al. , 2004 ) . Practice and application of freshly acquired accomplishments are needed for ELL pupils to guarantee command of content constructs. In the SI schoolroom, for pupils geting English, the demand to use the new information is of import because discoursing and making do abstract constructs concrete ( Echevarria et al. , 2007 ) . Application can happen in a figure of ways, such as bunch, utilizing in writing organisers, work outing jobs in concerted acquisition groups, composing in diaries, and treatment circles ( Bouchard, 2005 ) . These activities involve ELLs in relevant, meaningful application of what they are larning. For English scholars, application must besides include chances for them to pattern linguistic communication cognition in the schoolroom. Opportunities for societal interaction promote linguistic communication development can be achieved through treatment, working with spouses and little groups and describing out information orally and in authorship ( Bouchard, 2005 ) . Reading, composing, hearing, and talking are complex, cognitive linguistic communication processes that are interrelated and integrated ( Echevarria et al. , 2004 ) . Sheltered Instruction creates chances for ELLs to pattern and utilize all four spheres in an incorporate mode. ELLs benefit from multiple experiences that incorporate reading, promote interactions with others, supply the opportunity to listen to equals ââ¬Ë thoughts, and promote composing about what it is that they are larning. Besides, by learning through pupils ââ¬Ë preferred acquisition manners and encouraging pupils to pattern and use new cognition through multiple linguistic communication spheres, they will hold a more chances to develop their linguistic communication and content country cognition. Effective instructors of sheltered direction incorporate reappraisal and appraisal into their day-to-day lessons. In SI schoolrooms it is of import to find how good ELL pupils have understood and retained cardinal vocabulary and content constructs. Students, particularly those at the early phases of English proficiency, give considerable clip and energy into calculating out what the instructor is stating or the text is stating them at a basic degree ( Echevarria et al. , 2004 ) . Because of this, they are much less able to find which information among all they input they are having is most of import to retrieve. Teachers must hence take the clip to reexamine and sum up throughout the lesson non merely at the terminal as a wrap-up activity. SI helps pupils develop cardinal vocabulary by learning and so reexamining nomenclature and constructs through analogy and associating freshly learned words to other new words with the same construction or forms. Reviewing vocabulary besides involves pulling pupils ââ¬Ë attending to strain, parts of address, and sentence construction. Repeating and reenforcing linguistic communication forms helps ELLs become familiar with English constructions. In add-on, multiple exposures to identify vocabulary besides build acquaintance, assurance, and English proficiency. The more exposure pupils have to new words, particularly if the vocabulary is reinforced through multiple modes, the more likely they are to retrieve and utilize them ( Herrell et al. , 2004 ) . Students may pull a image to picture a construct or to retrieve a word. ELLs can show word significance through physical gestures or move out several words within the context of function drama. Activities that engage pupils in synergi stic pattern with words are effectual ways to advance academic linguistic communication development for ELL pupils ( Echevarria et al. , 2007 ) . Merely as it is of import to reexamine cardinal vocabulary throughout a lesson, it is besides indispensable that English scholars have cardinal content constructs reviewed during and at the terminal of a lesson ( Echavarria et al. , 2004 ) . Understandings are scaffolded in SI lessons when instructors stop and briefly sum up, along with the pupils ââ¬Ë engagement, the cardinal content covered to that point in the lesson. Students can besides sum up with spouses, write in diaries, or possibly list cardinal points on the board. For ELLs, it is of import to associate the reappraisal to the content aims so that the pupils stay focused on the indispensable content constructs of the lesson ( Echavarria et al. , 2008 ) . Appraisal occurs throughout a lesson to find if pupils are understanding and applying linguistic communication and content aims. Assessment must be linked to the direction and needs to aim the lesson aims. Merely as pupils need to cognize what the aims are, they need to be informed about how and what type of appraisals they will hold. Toward the terminal of the lesson, pupils ââ¬Ë progressed is assessed to find whether it is appropriate to travel on or to reexamine and reteach. Appraisals can be informal, reliable, multidimensional, and include multiple indexs that reflect pupil acquisition, accomplishment, and attitudes ( Hill, 2007 ) . As instructors in SI schoolrooms prepare for formal and informal appraisals, it is of import to observe that linguistic communication and content are intertwined in sheltered categories, dividing one from the other in the assessment procedure can be hard but necessary. When pupils demonstrate trouble or deficiency of public presentation, instructo rs need to find if it is the content that has non been mastered, or if it is a deficiency of English proficiency that is interfering with their acquisition and application of information. By be aftering multiple appraisals such as public presentation based undertakings, portfolios, diaries and undertakings, in add-on to more formalistic trials, pupils are given chances to show their cognition much more to the full. Assessment assortment is of import for ELLs because they are frequently unfamiliar with the type of standardised trials required in U.S. schools and may hold different testing and acquisition manners. Finally, to the extent possible, pupils should be evaluated on their personal advancement to find if acquisition has taken topographic point. In SI schoolrooms, where pupils frequently have different degrees of English linguistic communication proficiency, the value of multiple appraisals becomes evident. If instructors gather baseline informations on what their pupils know and can make with the content information before direction occurs and so what they know and can make afterwards, this can take to supportive feedback, and can supply for just and comprehensive judgements about pupil public presentation. In SI schoolrooms, there is a high degree of pupil battle and interaction with the instructor, with other pupils, and with text, which leads to lucubrate discourse and critical thought ( Echevarria et al. , 2008 ) . ELL pupils are explicitly taught functional linguistic communication accomplishments every bit good as how to negociate significance, confirm information, argue, persuade, and disagree. Teachers of SI introduce pupils to the schoolroom discourse community and demonstrate accomplishments such as taking bends in a conversation and disrupting courteously to inquire for elucidation. Through instructional conversation and meaningful activities, pupils pattern their English and content cognition. Sheltered direction, specifically SIOP, is characterized by careful attending to Ells typical 2nd linguistic communication development demands ( Echevarria et al. , 2007 ) . Sheltered direction plays a major function in a assortment of educational plan designs ( Genesee, 1999 ) . It may be portion of an ESL plan, a late-exit bilingual plan, a bipartisan bilingual submergence plan, a newcomer plan, or a foreign linguistic communication submergence plan. For pupils analyzing content-based ELL classs, SI frequently provides the span to the mainstream and the sum of SI provided should increase as pupils move toward passage out of these plans. Harmonizing to Echevarria et Al. ( 2008 ) any plan in which pupils are larning content through a non-native linguistic communication should utilize the sheltered direction attack. Mentions Bouchard, M. ( 2005 ) . Comprehension schemes for English linguistic communication scholars. New York: Scholastic Books. Echevarria, J. , & A ; Graves, A. ( 2007 ) . Sheltered content direction: Teaching English linguistic communication scholars with diverse disablements 3rd edition: Allyn and Bacon, 16-21, 56-72. Echevarria, J. , Vogt, M. , & A ; Short, D. ( 2008 ) . Making content comprehendible for English scholars: The SIOP theoretical account 3rd edition: Allyn and Bacon. Echevarria, J. , Vogt, M. , & A ; Short, D. ( 2004 ) . Making content comprehendible for English scholars: The SIOP theoretical account 2nd edition: Allyn and Bacon. Genesee, F. ( 1999 ) . Program options for linguistically diverse pupils. Educational Practice Report No.1. Washington, DC: Center for Research on Education, Diversity & A ; Excellence. Gunderson, L. ( 1991 ) . ESL literacy direction: A guidebook to theory and pattern. Englewood Cliffs, NJ: Regents/Prentice hall. Harrell, A. , & A ; Jordan, M. ( 2004 ) . 50 schemes for learning English linguistic communication scholars 2nd edition. Upper saddle River, NJ: Pearson Prentice Hall. Mentions Hill, J. ( 2007 ) . A participant ââ¬Ës manual for schoolroom direction that works for English linguistic communication scholars. Denver, Col: Mid-Continent Research for Education and Learning, 32-38. Krashen, S. ( 1985 ) . The input hypothesis: Issues and deductions. New York: Longman. National Clearinghouse for English Language Acquisition. ( 2007a. ) . Adjustments for English linguistic communication scholars. Washington, DC: Writer. Retrieved July 16, 2010, from hypertext transfer protocol: //www.ncela.gwu.edu/accountability/ Short, D. ( 1999 ) . Integrating linguistic communication and content for effectual sheltered direction plans. New York: Teachers College Press. Retrieved July 8, 2010, from hypertext transfer protocol: //tapestry.usf.edu/Short/resources.html Teachers of English to Speakers of Other Languages ( TESOL ) . ( 2007 ) . Meeting the challenges of content direction. Retrieved July 16, 2010, from hypertext transfer protocol: //everythingesl.net/inservices/judith.php U.S. Census Bureau, American Community Survey. ( 2005 ) . Characteristics of people who talk a linguistic communication other than English at place. Retrieved July 21, 2010, from hypertext transfer protocol: //factfinder.census.gov/servlet/ACSSAFFFacts? _event= & A ; geo_id=01000US & A ; _geo
Saturday, November 9, 2019
Alcoholism and Domestic Violence
Alcoholism, also known as alcohol dependence, is unfortunately a widespread ailment which spans people of all age groups and socioeconomic levels. The health risks of this disease, and alcoholism is a disease, are as widespread as the individuals who contract it. In addition to these health risks, alcoholism is also an influencing factor in another problem plaguing societies, domestic violence. Thus, alcohol and anger create a sometimes fatal combination.Alcoholism is a disease which can be described by degree. Alcohol dependence describes individuals who have developed a ââ¬Å"maladaptive patternâ⬠of alcohol consumption which is characterized by a developing alcohol tolerance, withdrawal symptoms, or hangovers, and the inability to stop drinking. It doesnââ¬â¢t stop there People with alcohol dependence may progress to alcohol abuse which can significantly interfere with their social lives, their work or their interpersonal relationships.In addition, this abuse can also cau se a host of related issues including ââ¬Å"major depression, dysthymia, mania, hypomania, panic disorder, phobias, generalized anxiety disorder, personality disorders, any drug use disorder,schizophrenia, and suicideâ⬠(Cargiulo 2007). According to the National Institute on Alcohol Abuse and Alcoholism (NIAAA), drinking up to 14 drinks in a week for men or seven drinks per week as a woman could indicate alcohol dependence. In addition, the NIAAA estimates that up to nearly 18 million Americans could be considered alcoholics (Lauer 2006).Despite the many mental and physiological problems that are associated with alcoholism, some of the most frightening are the health problems associated with the brain. Evidence exists that shows the damage that alcohol consumption does to the brain. Brain imaging studies have revealed that people with alcoholism have significant differences in parts of their brains than those without alcoholism. The brain volume is reduced in alcoholics as wel l as the blood flow to the brain.The reduced blood flow has been linked to a lowering of inhibitions and memory, impaired cognitive function in general and even damage to the corpus callosum (Cargiulo 2007). These problems can lead to long term brain damage. Lesions in the brain form in those with long term patterns of alcohol abuse. This can translate into Korsakoffââ¬â¢s disease which is characterized by motor impairment and thinking impairments which can affect a personââ¬â¢s ability to care for himself. In the end, the individual may have to be cared for institutionally.Alcohol affects the neurotransmitters in the brain. As the disease progresses to chronic status, the brain cells begin to adapt to the alcohol that seems to reside permanently in the brain. As a result, the brain becomes reliant on the alcohol to work. If alcohol is removed, the symptoms of withdrawal take longer and longer to subside. Ultimately, the brain tissue will rebel, in a way, and the withdrawal sy mptoms can be severe, even fatal. Once the cells in the brain die, they cannot be regenerated (Shoemaker 2003). These effects seem to affect males to a greater degree than females.This fact can be explained by differences in drinking patters, choice of alcoholic drinks, rate of alcohol metabolism and the protective effects of hormones such as estrogen (de Bruin, 2005) As such, alcohol dependency and abuse is three times more prominent in men as it is in women even though evidence suggests that for both genders, the numbers are underreported (Cargiulo 2007). As if the physical effects on the body were not bad enough, the behaviors of individuals who are addicted to alcohol are also quite dangerous.The drinkers find themselves to be less inhibited and more willing to engage in risky behaviors. Many of these behaviors can be characterized as aggressive and violent. One of the worst that researchers find among alcoholics is domestic violence or intimate partner violence (IPV). The Acade my of Domestic Violence has defined domestic violence as ââ¬Å"a deliberate pattern of abusive tactics used by one partner in an intimate relationship to obtain and maintain power and control over the other personâ⬠which includes physical, sexual, psychological, emotional and economic abuses (Niolon 2004)The types of domestic violence have been organized by Dr. Richard Niolon (2004). He identifies one type as common couple violence which occurs in one or two isolated incidences over the course of the couplesââ¬â¢ relationship. Though painful at the time, this type is not usually seen as a recurring pattern of abuse and control. The second type is identified by Niolon (2004) as intimate terrorism in which violence is used as a means of manipulation and control relatively regularly.Mutual violent control occurs more often when both the male and the female fight each other, and dysphoric-borderline violence is indicative of a dependent, emotional fragile individual who resort s to violence as a last resort. This type of violence often occurs when the abused person in the relationship snaps and lashes out violently against the other partner or when a new set of circumstances radically increases the frustration levels of one of the partners in the relationship, and he or she lashes out as a result of this new situation (Niolon 2004).These stages of violence typically follow a predictable cycle. The first stage of this cycle is a calm period in which tension slowly builds. Minor incidents may occur in this stage which can continue for various periods of time. The second stage is the one in which the abuser seems to explode and actually engage in the violence. Outside parties may have to intervene to stop the onslaught. The third states is called the honeymoon stage because the abuser will show distinct remorse for his actions, apologize profusely, and even shower the abused with gifts and affection, even promises.Unfortunately, the abused is likely to forgi ve the abuser at this point. (Niolon 2004). Risk factors for IPV include lower educational levels, lower income and/or employment levels, and, of course, alcohol misuse (Jeyaseelan, 2004). Sadly, alcohol and IPV often do go hand in hand. Not surprising, the most common locations for IPV to occur is in the home and at bars. According to interviews with abused wives, men were much more likely to have been drinking during the attacks than not.When the abusive husbands were interviewed, they reported to have had at least six drinks before the onset of the violence (Quigley and Leonard, 2004/2005). Thus the concurrence of alcoholism and IPV is shown. When drinking, a dangerous combination of increased aggression and reduced inhibition lead to these batterings. Many studies support this problem, which again seems to afflict more men than women. Quigley and Leonard (2004/2005) recount a study by Kaufman, Kantor and Straus in 1990 which found that the husbands heavy drinking was associated with husband on wife violence.Further studies show that a husband who drinks early in marriage is more prone to IPV later in marriage, and husbands who drink heavily before marriage are more likely to be violent toward their wives in the very first year of marriage (Quigley and Leonard, 2004/2005). In addition, these authors cite Caetano in noting that there are racial differences involved in IPC. They note that ââ¬Å"nineteen percent of European American husbands and 24 percent of Hispanic husbands who drank at least five drinks a week committed IPV, as opposed to 40 percent of African American husbands who drankâ⬠(Quigley and Leonard, 2004/2005).This has harrowing implications for women of all races, particularly African American women. Galvani (2004) gives several possible reasons why this may be true. Physiological theories argue that ethanol, the drug in alcohol increase aggression biologically. A theory known as Disinhibition Theory notes the earlier link between alcoho l and cognitive function, specifically the portion of the brain mentioned above that regulates levels if inhibition. The Deviance Disavowal theory argues that the abusers use alcohol as a reason for their behavior and consciously drinks so that they can blame the alcohol for their actions.Social Learning theories explain that people will act in a way based on their experiences around others. Therefore, parents and societal expectations can lead to alcoholic abuse and abusive behaviors (Galvani, 2004). Both alcoholism and IPV are scourges upon society, creating physical and mental damage. When these are combined, their effects are even stronger and more widespread. With hope, individuals who find themselves in these situations will soon seek help to avoid permanent tragedy. References Cargiulo, T. (2007).Understanding the health impact of alcohol dependence. American Journal of Health-System Pharmacy 64: S1-S17 De Bruin, EA. (2005) Does alcohol intake relate to brain volume loss? The Brown University Digest of Addiction Theory & Application 24 (7): 5-6 Galvani, S. (2004). Responsible disinhibition: Alcohol, men and violence to women. Addiction Research & Theory 12 (4): 357-371 Jeyaseelan, L et al. (2004). World studies of abuse in the family environment ââ¬â risk factors for physical intimate partner violence.Injury Control & Safety Promotion 11 (2): 117-124. Lauer, CS. (2006). When drinking turns serious. Modern Healthcare 36 (16): 22 Niolan, R. (2004). Types and Cycles of Domestic Violence. Retrieved 1 May 207 from http://www. psychpage. com/learning/index. html Quigley, BM & Leonard, KE. (2004/2005). Alcohol Use and Violence Among Young Adults. Alcohol Research & Health 28 (4): 191-194 Shoemaker, W. (2003). Alcoholââ¬â¢s Effects on the Brain. Nutritional Health Review: The Consumerââ¬â¢s Medical Journal 88: 3-8 .
Thursday, November 7, 2019
Reading Critiques 5 Essays (523 words) - Assumption, Logic
Reading Critiques 5 Essays (523 words) - Assumption, Logic Philosophy in Relation to Science, Religion, and Mythology David Edgerton III Howard University Subjects like science, religion, mythology, philosophy to quench our thirst for complete knowledge. P hilosophy is used to create new knowledge and solve problems that seem impossible . While science uses a general description of reality to handle problems philosophy challenges problems in a universal ways. Philosophy questions problems on a broad scale aff ecting everyone in the world while religion limits itself to sacred texts. Mythology attempts to find the answers of the world through stories, while philosophy uses reality and reason to answers the world's questions. Using Francis Clauder's , "The Wonder of Philosophy," I will identify the similarities and differences of problem solving of philosophy compared to other subjects. Science is often synonymous with the word fact but Klauder asserts that "science is error caused precipitous judgment "( Klauder,1999, p. 21) In other words, science is error because it is never constant! Like philosophy, science is based off of a belief. F or example gravity. No one knows why gravity exists or how it works but we all believe our feet will stay planted on the ground. Philosophy is a belief that if you practice philosophy you will have an overall better existence. Klaudersaid that " Philosophy holds the criterion of truth and happiness"( Klauder, 1999, p. 19). Based on this information, the reader can see that the author believes that science and philosophy are both faith based subjects Religion is completely rooted in faith , which is complete trust or confidence in someone or something. Without faith there is no religion. Klauder believes religion is "search for eternal truths, happiness, moral obligation and consensus of mankind" .( Klauder, 1999, p. 22) Philosophy is rooted in these beliefs as w ell. The only real difference in philosophy and religion is that religion uses "sacred texts". Philosophers do not have a text to refer to , their faith is rooted "by way of denial and by way of supereminence"( Klauder, 1999, p. 23). While philosophy and rel igion are different they are still both centered around the idea of finding the answers to world's most disputed questions. Mythology are stories. They depict natural phenomena on earth and situations and try to use "faculty of thought," ( Klauder, 1999, p . 43) to see how they relate in everyday . Philosophy also considers certain phenomena and asks "what it means for it to be" ( Klauder , 1999 , p. 53). It takes a given situation and uses thinking on thinking to determine what exactly something means. Mythology uses this same pattern of thinking on thinking in a different way determine a solution or a reason for a problem, In conclusion, although philosophy appears very from other subject like science religion and mythology they all are the same because they attempt to solve issues. Although they solve these problems in unique ways they all have the same goal. People are looking for answers everyday to answer life questions and these subjects attempts to find the answers.
Tuesday, November 5, 2019
Using Quotes About Yourself
Using Quotes About Yourself When you sign up on a social networking or blogging site, you find a corner that is usually titled: About Me. In this space, you are expected to introduce yourself to the world: who you are and how you define yourself. While usually, you have no problem rambling on about yourself, you somehow feel disconcerted when you have to pen a few words to describe yourself. What do you write? How do you put it in eloquent words? And are you really being honest or simply spinning a yarn? When the two words ââ¬â About Me ââ¬â stare at your face, you get unexpectedly paralyzed. Suddenly, we face the inability to summarize a lifetime of dreams and desires in the scant space provided for the benefit of curious friends and other Internet surfers. How Do You Describe Yourself? So how should you put your best foot forward? Should you brag or be modest? Should you be witty or straight-laced? If you want to make a strong impression on your readers, start off with a smart quote about you. You will get lots of ideas from this collection of quotes about yourself. Quotes for Your Profile Each one of us gets lost in the chaos that we call life. And with adequate doses of inspiration, we manage to rediscover ourselves. Not everyone is blessed with the power of words. Hence, it is only natural to seek help. You may not have read the works of Mark Twain or Rudyard Kipling or Robert Frost, but their intelligent quotes can give your profile page a smart makeover. Choose Your Profile Statement From Witty and Wise Authors Standup comedian George Carlin said, The reason I talk to myself is that Im the only one whose answers I accept. If you like Carlins sense of humor, take a look at my collection of George Carlin quotations. However, if philosophy is your thing, consider quotes from Confucius, the famous Chinese philosopher. His words find resonance, even though it has been millennia since he walked the earth. Among the many evergreen Confucius sayings, is one that remains meaningful despite its brevity, And remember, no matter where you go, there you are. Strangely enough, it sounds a lot like something Dr. Seuss might say. Find Your Favorite Quotes Here If you are tired of rifling through page after page of quotations with the hope of finding a suitable one for your online profile page, take a look at this collection of profile quotes. You will find a diverse set of clever quotes from wisdom to humor and inspiration. There are quotes for teens and parents. For instance, if you are a parent of young kids, you might find novelist Henry Fieldings quote hilarious, When children are doing nothing, they are doing mischief. Make a Great First Impression Of course, the Internet is not the only place when you may need to talk about yourself. Go job-hunting and you will inevitably have to answer the clichà ©d question that all interviewers love to ask, Tell me about yourself. No matter how seasoned an interviewee you are, this question will take the wind off your sails. Since you have no clue what your interviewer expects to hear, you begin to mumble incoherent adjectives that may seem alien to your own ears. You are doomed if the interviewer latches on to one of those adjectives and asks you to elaborate. Take the Help of Literary Giants You must hit all the right notes in order to make a good first impression. How do you do that? I am reminded of a cheeky Oscar Wilde quote, I am the only person in the world I should like to know thoroughly. Unfortunately, using witticisms will not do you any good. To stay on safer ground, follow William Shakespeares advice, Men should be what they seem. So be original and save the wit for a rainy day. Find Your Unique Selling Proposition (USP) Reticent people often avoid social interaction as far as possible. Without adequate interpersonal skills, shy people are often confounded when asked to describe themselves. Their introversion prevents them from building new relationships. Give yourself a confidence boost by reading these uniqueness quotes. Artist Henri Matisse had his insecurities. He confessed, It has bothered me all my life that I do not paint like everybody else. Yet, Matisses individuality set him apart from his peers. You can also find your unique appeal and celebrate it. Get to Know the Real You Do you know the real you? Are you sure that the person you portray yourself as is the real you? Do you find yourself trapped in a conundrum of duty and role so much that you have forgotten who you really are? How to Rediscover Yourself You dont need to meditate under a tree to find the real you. You also dont need to go backpacking around the Arctic Circle to find the meaning of life. To discover your inherent uniqueness, all you need is a nudge in the right direction. You could get it from a scene in a movie, or a quote from a book. You could even get it while chatting with your friends. Sometimes, meaningful quotes can put you on the path of self-discovery. If you are seeking self-knowledge, quotes on reflection could help you look deep inside your soul. As ancient Chinese monk Hui-Neng rightly said, Look within! The secret is inside you.
Saturday, November 2, 2019
Plan organize and deliver group based learning Essay
Plan organize and deliver group based learning - Essay Example Iââ¬â¢ve looked at this unit of competency to see how conflict resolution suited and noticed there is an entire section dedicated to it ââ¬â ââ¬ËDeal effectively with issues, problems and conflictsââ¬â¢. I need your urgent help. Can you please provide a training session that deals simply with this issue for my new staff, ASAP. I had noticed there have been a few conflicts between my new and existing staff over various issues and feel this topic needs to be our first priority. I can give you 40 minutes next Tuesday morning to conduct the session. The following information may assist you with delivering this subject: 1. It is hoped that using mutual respect and open communication to discuss the issue that a resolution can be reached. This will include all parties concentrating on the problem and reaching a solution. No personal or derogatory comments from either party will be tolerated. 3. If conflict continues to occur due to this issue, mediation in the form of HR Personnel will be used to have a round-table discussion. If either employee is found to be in breach of the Town & City Cinemas Code of Conduct, reprimand steps will be taken. People should be treated as individuals with rights to be honoured and defended. Respect empowers others to claim their rights and to achieve their potential. Respect for the rights of other people is the basis on which individuals become members of a community and accept their social responsibilities to behave with integrity. The principle of taking personal and professional responsibility requires not only that people avoid doing harm to others but that they exhibit courteous behaviour upholding the standards expected of all members of the organisation as part of achieving a common good. In so doing they are expected to protect the rights of others and respect the diversity of cultures and peoples. Those well-positioned enough to assert their rights
Subscribe to:
Posts (Atom)